ID: 982987715

View in Genome Browser
Species Human (GRCh38)
Location 4:162232034-162232056
Sequence CACAGGGATAGAGCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982987715_982987720 17 Left 982987715 4:162232034-162232056 CCTTGGGTAGCTCTATCCCTGTG No data
Right 982987720 4:162232074-162232096 CCCCTCCCAGTTGCTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982987715 Original CRISPR CACAGGGATAGAGCTACCCA AGG (reversed) Intergenic
No off target data available for this crispr