ID: 982987744

View in Genome Browser
Species Human (GRCh38)
Location 4:162232199-162232221
Sequence ACTAGGCAGTGCCCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982987738_982987744 -6 Left 982987738 4:162232182-162232204 CCTCTTCTCACAGCTCCACTAGG No data
Right 982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG No data
982987735_982987744 21 Left 982987735 4:162232155-162232177 CCATTCTGGGGTCTGGAGGACAG No data
Right 982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG No data
982987737_982987744 -5 Left 982987737 4:162232181-162232203 CCCTCTTCTCACAGCTCCACTAG No data
Right 982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982987744 Original CRISPR ACTAGGCAGTGCCCCAGTGG GGG Intergenic