ID: 982988289

View in Genome Browser
Species Human (GRCh38)
Location 4:162238386-162238408
Sequence CATGAGAAGCCAAATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982988289_982988300 26 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988300 4:162238435-162238457 AGGGAGAAAGGACAGGTAAGAGG No data
982988289_982988298 14 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988298 4:162238423-162238445 TGGGATGGAGCAAGGGAGAAAGG No data
982988289_982988293 -5 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988293 4:162238404-162238426 TCATGATTTCTGACCATTCTGGG No data
982988289_982988296 7 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988296 4:162238416-162238438 ACCATTCTGGGATGGAGCAAGGG No data
982988289_982988295 6 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988295 4:162238415-162238437 GACCATTCTGGGATGGAGCAAGG No data
982988289_982988299 19 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988299 4:162238428-162238450 TGGAGCAAGGGAGAAAGGACAGG No data
982988289_982988294 -1 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988294 4:162238408-162238430 GATTTCTGACCATTCTGGGATGG No data
982988289_982988292 -6 Left 982988289 4:162238386-162238408 CCTCCCTCATTTGGCTTCTCATG No data
Right 982988292 4:162238403-162238425 CTCATGATTTCTGACCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982988289 Original CRISPR CATGAGAAGCCAAATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr