ID: 982989005

View in Genome Browser
Species Human (GRCh38)
Location 4:162246685-162246707
Sequence ATCCTTTGCCTACTTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982989003_982989005 14 Left 982989003 4:162246648-162246670 CCGCATAAATGTCTTCTTTTGAG 0: 1580
1: 1463
2: 1351
3: 2048
4: 4205
Right 982989005 4:162246685-162246707 ATCCTTTGCCTACTTTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982989005 Original CRISPR ATCCTTTGCCTACTTTTGAT GGG Intergenic
No off target data available for this crispr