ID: 982990106

View in Genome Browser
Species Human (GRCh38)
Location 4:162263222-162263244
Sequence CCCTGGCGCCGGGCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982990099_982990106 7 Left 982990099 4:162263192-162263214 CCACCAGAAGATTTGCTGAGGGT No data
Right 982990106 4:162263222-162263244 CCCTGGCGCCGGGCTCCTTGAGG No data
982990101_982990106 4 Left 982990101 4:162263195-162263217 CCAGAAGATTTGCTGAGGGTGGT No data
Right 982990106 4:162263222-162263244 CCCTGGCGCCGGGCTCCTTGAGG No data
982990096_982990106 11 Left 982990096 4:162263188-162263210 CCTGCCACCAGAAGATTTGCTGA No data
Right 982990106 4:162263222-162263244 CCCTGGCGCCGGGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982990106 Original CRISPR CCCTGGCGCCGGGCTCCTTG AGG Intergenic