ID: 983002711

View in Genome Browser
Species Human (GRCh38)
Location 4:162438236-162438258
Sequence TTCACAGCACCACTCCTAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983002711_983002712 2 Left 983002711 4:162438236-162438258 CCGCTTAGGAGTGGTGCTGTGAA No data
Right 983002712 4:162438261-162438283 TAACAGTGCTTGTCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983002711 Original CRISPR TTCACAGCACCACTCCTAAG CGG (reversed) Intergenic
No off target data available for this crispr