ID: 983003890

View in Genome Browser
Species Human (GRCh38)
Location 4:162458126-162458148
Sequence CTGTGTAAGAAAAGGTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983003886_983003890 29 Left 983003886 4:162458074-162458096 CCATCGTAAATACAAGAAGTCGG No data
Right 983003890 4:162458126-162458148 CTGTGTAAGAAAAGGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983003890 Original CRISPR CTGTGTAAGAAAAGGTTTCT GGG Intergenic
No off target data available for this crispr