ID: 983008615

View in Genome Browser
Species Human (GRCh38)
Location 4:162517757-162517779
Sequence ACTTAACTGCAGAATATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983008614_983008615 7 Left 983008614 4:162517727-162517749 CCTATGGGATATAAAAACATAAA No data
Right 983008615 4:162517757-162517779 ACTTAACTGCAGAATATCACTGG No data
983008612_983008615 21 Left 983008612 4:162517713-162517735 CCTCCTAAAGACATCCTATGGGA No data
Right 983008615 4:162517757-162517779 ACTTAACTGCAGAATATCACTGG No data
983008613_983008615 18 Left 983008613 4:162517716-162517738 CCTAAAGACATCCTATGGGATAT No data
Right 983008615 4:162517757-162517779 ACTTAACTGCAGAATATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983008615 Original CRISPR ACTTAACTGCAGAATATCAC TGG Intergenic
No off target data available for this crispr