ID: 983019134

View in Genome Browser
Species Human (GRCh38)
Location 4:162653529-162653551
Sequence AAGAAAAAGGACAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983019134_983019141 9 Left 983019134 4:162653529-162653551 CCAACCTCCTTGTCCTTTTTCTT No data
Right 983019141 4:162653561-162653583 GCCAGTTTTGCATTGCAGTCTGG No data
983019134_983019143 12 Left 983019134 4:162653529-162653551 CCAACCTCCTTGTCCTTTTTCTT No data
Right 983019143 4:162653564-162653586 AGTTTTGCATTGCAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983019134 Original CRISPR AAGAAAAAGGACAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr