ID: 983024903

View in Genome Browser
Species Human (GRCh38)
Location 4:162724518-162724540
Sequence CAGGGTAAACAGATGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983024903_983024910 -2 Left 983024903 4:162724518-162724540 CCAGCCCCCATCTGTTTACCCTG No data
Right 983024910 4:162724539-162724561 TGATACACAGATTTCTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983024903 Original CRISPR CAGGGTAAACAGATGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr