ID: 983028762

View in Genome Browser
Species Human (GRCh38)
Location 4:162771871-162771893
Sequence CTAAAAGATTTCTTACACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983028762_983028764 22 Left 983028762 4:162771871-162771893 CCAATGTGTAAGAAATCTTTTAG No data
Right 983028764 4:162771916-162771938 TCCTCCAGAACAAAGAGAAGAGG No data
983028762_983028767 27 Left 983028762 4:162771871-162771893 CCAATGTGTAAGAAATCTTTTAG No data
Right 983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983028762 Original CRISPR CTAAAAGATTTCTTACACAT TGG (reversed) Intergenic
No off target data available for this crispr