ID: 983028763

View in Genome Browser
Species Human (GRCh38)
Location 4:162771904-162771926
Sequence GTTCTGGAGGACATATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983028763_983028767 -6 Left 983028763 4:162771904-162771926 CCAATATATATGTCCTCCAGAAC No data
Right 983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG No data
983028763_983028769 5 Left 983028763 4:162771904-162771926 CCAATATATATGTCCTCCAGAAC No data
Right 983028769 4:162771932-162771954 GAAGAGGAGAGGAGATATGGAGG No data
983028763_983028768 2 Left 983028763 4:162771904-162771926 CCAATATATATGTCCTCCAGAAC No data
Right 983028768 4:162771929-162771951 AGAGAAGAGGAGAGGAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983028763 Original CRISPR GTTCTGGAGGACATATATAT TGG (reversed) Intergenic
No off target data available for this crispr