ID: 983028767

View in Genome Browser
Species Human (GRCh38)
Location 4:162771921-162771943
Sequence CAGAACAAAGAGAAGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983028763_983028767 -6 Left 983028763 4:162771904-162771926 CCAATATATATGTCCTCCAGAAC No data
Right 983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG No data
983028762_983028767 27 Left 983028762 4:162771871-162771893 CCAATGTGTAAGAAATCTTTTAG No data
Right 983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983028767 Original CRISPR CAGAACAAAGAGAAGAGGAG AGG Intergenic
No off target data available for this crispr