ID: 983029811

View in Genome Browser
Species Human (GRCh38)
Location 4:162785595-162785617
Sequence AAGAAGAAGAAGAAGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983029808_983029811 23 Left 983029808 4:162785549-162785571 CCAGCCTGGGCGACAGAGCGAGA 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
Right 983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG No data
983029809_983029811 19 Left 983029809 4:162785553-162785575 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG No data
983029810_983029811 -2 Left 983029810 4:162785574-162785596 CCGTCTCAAAAAAAAAAAAAGAA 0: 3017
1: 89714
2: 69208
3: 85321
4: 120915
Right 983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983029811 Original CRISPR AAGAAGAAGAAGAAGTAGTC AGG Intergenic
No off target data available for this crispr