ID: 983029889

View in Genome Browser
Species Human (GRCh38)
Location 4:162786596-162786618
Sequence TACTAACACCCTAGGCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983029885_983029889 20 Left 983029885 4:162786553-162786575 CCATAAAGGATTATGAAGAAAAA No data
Right 983029889 4:162786596-162786618 TACTAACACCCTAGGCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983029889 Original CRISPR TACTAACACCCTAGGCACTA GGG Intergenic
No off target data available for this crispr