ID: 983033601

View in Genome Browser
Species Human (GRCh38)
Location 4:162835275-162835297
Sequence AGGATGGGGCTATGATTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983033601_983033606 -2 Left 983033601 4:162835275-162835297 CCTATCAATCATAGCCCCATCCT No data
Right 983033606 4:162835296-162835318 CTCTAACAGTCCAACAAAAAAGG No data
983033601_983033607 6 Left 983033601 4:162835275-162835297 CCTATCAATCATAGCCCCATCCT No data
Right 983033607 4:162835304-162835326 GTCCAACAAAAAAGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983033601 Original CRISPR AGGATGGGGCTATGATTGAT AGG (reversed) Intergenic
No off target data available for this crispr