ID: 983033607

View in Genome Browser
Species Human (GRCh38)
Location 4:162835304-162835326
Sequence GTCCAACAAAAAAGGCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983033601_983033607 6 Left 983033601 4:162835275-162835297 CCTATCAATCATAGCCCCATCCT No data
Right 983033607 4:162835304-162835326 GTCCAACAAAAAAGGCTTCCAGG No data
983033602_983033607 -8 Left 983033602 4:162835289-162835311 CCCCATCCTCTAACAGTCCAACA No data
Right 983033607 4:162835304-162835326 GTCCAACAAAAAAGGCTTCCAGG No data
983033603_983033607 -9 Left 983033603 4:162835290-162835312 CCCATCCTCTAACAGTCCAACAA No data
Right 983033607 4:162835304-162835326 GTCCAACAAAAAAGGCTTCCAGG No data
983033604_983033607 -10 Left 983033604 4:162835291-162835313 CCATCCTCTAACAGTCCAACAAA No data
Right 983033607 4:162835304-162835326 GTCCAACAAAAAAGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983033607 Original CRISPR GTCCAACAAAAAAGGCTTCC AGG Intergenic
No off target data available for this crispr