ID: 983040007

View in Genome Browser
Species Human (GRCh38)
Location 4:162914336-162914358
Sequence CTTCCCTGTACCACAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983040007_983040010 13 Left 983040007 4:162914336-162914358 CCTGCAGCTGTGGTACAGGGAAG No data
Right 983040010 4:162914372-162914394 CACCACACAACTCCCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983040007 Original CRISPR CTTCCCTGTACCACAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr