ID: 983040337

View in Genome Browser
Species Human (GRCh38)
Location 4:162917447-162917469
Sequence GTTCCATTTAAACACATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983040334_983040337 16 Left 983040334 4:162917408-162917430 CCCAGTAACTGAAACAAGAAAAA No data
Right 983040337 4:162917447-162917469 GTTCCATTTAAACACATTGCTGG No data
983040333_983040337 17 Left 983040333 4:162917407-162917429 CCCCAGTAACTGAAACAAGAAAA No data
Right 983040337 4:162917447-162917469 GTTCCATTTAAACACATTGCTGG No data
983040335_983040337 15 Left 983040335 4:162917409-162917431 CCAGTAACTGAAACAAGAAAAAA No data
Right 983040337 4:162917447-162917469 GTTCCATTTAAACACATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983040337 Original CRISPR GTTCCATTTAAACACATTGC TGG Intergenic
No off target data available for this crispr