ID: 983045058

View in Genome Browser
Species Human (GRCh38)
Location 4:162976460-162976482
Sequence CGAGGTAGGTGGATCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246245
Summary {0: 304, 1: 13317, 2: 50253, 3: 84858, 4: 97513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045058_983045066 9 Left 983045058 4:162976460-162976482 CCTCAGGTGATCCACCTACCTCG 0: 304
1: 13317
2: 50253
3: 84858
4: 97513
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data
983045058_983045068 30 Left 983045058 4:162976460-162976482 CCTCAGGTGATCCACCTACCTCG 0: 304
1: 13317
2: 50253
3: 84858
4: 97513
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045058 Original CRISPR CGAGGTAGGTGGATCACCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr