ID: 983045060

View in Genome Browser
Species Human (GRCh38)
Location 4:162976471-162976493
Sequence CTTTGGGAGGCCGAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576158
Summary {0: 1286, 1: 59092, 2: 190542, 3: 192166, 4: 133072}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045060_983045068 19 Left 983045060 4:162976471-162976493 CCACCTACCTCGGCCTCCCAAAG 0: 1286
1: 59092
2: 190542
3: 192166
4: 133072
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045060_983045066 -2 Left 983045060 4:162976471-162976493 CCACCTACCTCGGCCTCCCAAAG 0: 1286
1: 59092
2: 190542
3: 192166
4: 133072
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045060 Original CRISPR CTTTGGGAGGCCGAGGTAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr