ID: 983045061

View in Genome Browser
Species Human (GRCh38)
Location 4:162976474-162976496
Sequence GTACTTTGGGAGGCCGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 696828
Summary {0: 988, 1: 42594, 2: 195009, 3: 274734, 4: 183503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045061_983045068 16 Left 983045061 4:162976474-162976496 CCTACCTCGGCCTCCCAAAGTAC 0: 988
1: 42594
2: 195009
3: 274734
4: 183503
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045061_983045066 -5 Left 983045061 4:162976474-162976496 CCTACCTCGGCCTCCCAAAGTAC 0: 988
1: 42594
2: 195009
3: 274734
4: 183503
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045061 Original CRISPR GTACTTTGGGAGGCCGAGGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr