ID: 983045062

View in Genome Browser
Species Human (GRCh38)
Location 4:162976478-162976500
Sequence CTCAGTACTTTGGGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 646052
Summary {0: 179, 1: 9029, 2: 144833, 3: 285429, 4: 206582}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045062_983045066 -9 Left 983045062 4:162976478-162976500 CCTCGGCCTCCCAAAGTACTGAG 0: 179
1: 9029
2: 144833
3: 285429
4: 206582
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data
983045062_983045068 12 Left 983045062 4:162976478-162976500 CCTCGGCCTCCCAAAGTACTGAG 0: 179
1: 9029
2: 144833
3: 285429
4: 206582
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045062 Original CRISPR CTCAGTACTTTGGGAGGCCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr