ID: 983045063

View in Genome Browser
Species Human (GRCh38)
Location 4:162976484-162976506
Sequence TGTAATCTCAGTACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 758333
Summary {0: 633, 1: 26893, 2: 329956, 3: 261714, 4: 139137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045063_983045068 6 Left 983045063 4:162976484-162976506 CCTCCCAAAGTACTGAGATTACA 0: 633
1: 26893
2: 329956
3: 261714
4: 139137
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045063 Original CRISPR TGTAATCTCAGTACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr