ID: 983045064

View in Genome Browser
Species Human (GRCh38)
Location 4:162976487-162976509
Sequence CACTGTAATCTCAGTACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404339
Summary {0: 2, 1: 68, 2: 1897, 3: 38475, 4: 363897}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045064_983045068 3 Left 983045064 4:162976487-162976509 CCCAAAGTACTGAGATTACAGTG 0: 2
1: 68
2: 1897
3: 38475
4: 363897
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045064 Original CRISPR CACTGTAATCTCAGTACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr