ID: 983045065

View in Genome Browser
Species Human (GRCh38)
Location 4:162976488-162976510
Sequence GCACTGTAATCTCAGTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045065_983045068 2 Left 983045065 4:162976488-162976510 CCAAAGTACTGAGATTACAGTGC No data
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045065 Original CRISPR GCACTGTAATCTCAGTACTT TGG (reversed) Intergenic
No off target data available for this crispr