ID: 983045066

View in Genome Browser
Species Human (GRCh38)
Location 4:162976492-162976514
Sequence AGTACTGAGATTACAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045060_983045066 -2 Left 983045060 4:162976471-162976493 CCACCTACCTCGGCCTCCCAAAG 0: 1286
1: 59092
2: 190542
3: 192166
4: 133072
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data
983045062_983045066 -9 Left 983045062 4:162976478-162976500 CCTCGGCCTCCCAAAGTACTGAG 0: 179
1: 9029
2: 144833
3: 285429
4: 206582
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data
983045057_983045066 14 Left 983045057 4:162976455-162976477 CCTGACCTCAGGTGATCCACCTA 0: 796
1: 32766
2: 73984
3: 99463
4: 106138
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data
983045061_983045066 -5 Left 983045061 4:162976474-162976496 CCTACCTCGGCCTCCCAAAGTAC 0: 988
1: 42594
2: 195009
3: 274734
4: 183503
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data
983045058_983045066 9 Left 983045058 4:162976460-162976482 CCTCAGGTGATCCACCTACCTCG 0: 304
1: 13317
2: 50253
3: 84858
4: 97513
Right 983045066 4:162976492-162976514 AGTACTGAGATTACAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045066 Original CRISPR AGTACTGAGATTACAGTGCC TGG Intergenic
No off target data available for this crispr