ID: 983045068

View in Genome Browser
Species Human (GRCh38)
Location 4:162976513-162976535
Sequence GGCCCTTTTGATGTTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983045063_983045068 6 Left 983045063 4:162976484-162976506 CCTCCCAAAGTACTGAGATTACA 0: 633
1: 26893
2: 329956
3: 261714
4: 139137
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045061_983045068 16 Left 983045061 4:162976474-162976496 CCTACCTCGGCCTCCCAAAGTAC 0: 988
1: 42594
2: 195009
3: 274734
4: 183503
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045060_983045068 19 Left 983045060 4:162976471-162976493 CCACCTACCTCGGCCTCCCAAAG 0: 1286
1: 59092
2: 190542
3: 192166
4: 133072
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045065_983045068 2 Left 983045065 4:162976488-162976510 CCAAAGTACTGAGATTACAGTGC No data
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045064_983045068 3 Left 983045064 4:162976487-162976509 CCCAAAGTACTGAGATTACAGTG 0: 2
1: 68
2: 1897
3: 38475
4: 363897
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045062_983045068 12 Left 983045062 4:162976478-162976500 CCTCGGCCTCCCAAAGTACTGAG 0: 179
1: 9029
2: 144833
3: 285429
4: 206582
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data
983045058_983045068 30 Left 983045058 4:162976460-162976482 CCTCAGGTGATCCACCTACCTCG 0: 304
1: 13317
2: 50253
3: 84858
4: 97513
Right 983045068 4:162976513-162976535 GGCCCTTTTGATGTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983045068 Original CRISPR GGCCCTTTTGATGTTCAGAC AGG Intergenic
No off target data available for this crispr