ID: 983050055

View in Genome Browser
Species Human (GRCh38)
Location 4:163035490-163035512
Sequence CTCACACAGAAGTCTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983050052_983050055 -2 Left 983050052 4:163035469-163035491 CCAGAAATCCCATTATATAGGCT No data
Right 983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG No data
983050051_983050055 -1 Left 983050051 4:163035468-163035490 CCCAGAAATCCCATTATATAGGC No data
Right 983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG No data
983050053_983050055 -10 Left 983050053 4:163035477-163035499 CCCATTATATAGGCTCACACAGA No data
Right 983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG No data
983050049_983050055 0 Left 983050049 4:163035467-163035489 CCCCAGAAATCCCATTATATAGG No data
Right 983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983050055 Original CRISPR CTCACACAGAAGTCTGAACA AGG Intergenic
No off target data available for this crispr