ID: 983052346

View in Genome Browser
Species Human (GRCh38)
Location 4:163063062-163063084
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983052346_983052349 -9 Left 983052346 4:163063062-163063084 CCTACAAATGTGGTACAGTCCAG No data
Right 983052349 4:163063076-163063098 ACAGTCCAGGACCCCTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983052346 Original CRISPR CTGGACTGTACCACATTTGT AGG (reversed) Intergenic
No off target data available for this crispr