ID: 983057324

View in Genome Browser
Species Human (GRCh38)
Location 4:163113330-163113352
Sequence TAGGAGAGGAATTATGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983057324 Original CRISPR TAGGAGAGGAATTATGAAAG TGG (reversed) Intronic
902139301 1:14338913-14338935 TAGGAGAGCCATGATGGAAGGGG + Intergenic
902196143 1:14799855-14799877 AAGGAGAGGAATTCTGATGGGGG - Intronic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
904243764 1:29170797-29170819 GAGAAGAGGAAGTCTGAAAGAGG - Intronic
904381416 1:30113699-30113721 CAGGAGAGGAAGGAAGAAAGTGG + Intergenic
904639038 1:31908359-31908381 TAGGAGAGGAAGGAAAAAAGAGG + Exonic
905138683 1:35822583-35822605 CAGGAGAGGATTTTGGAAAGAGG + Intronic
906089080 1:43162418-43162440 TATGGCATGAATTATGAAAGAGG + Intergenic
906724963 1:48037409-48037431 CAGGAGAGGGAGAATGAAAGGGG + Intergenic
908227093 1:62067099-62067121 AAGAATAGGAATTATGAGAGGGG - Intronic
908414922 1:63903954-63903976 TAGGAAAGGTTTTATGAAGGAGG + Intronic
909295359 1:73940714-73940736 TAGGTGAGGCATGATGAGAGAGG + Intergenic
909320187 1:74275532-74275554 TAGGGAAGGAGTTATGAGAGGGG + Intronic
909706311 1:78588847-78588869 CAGGTAAGGACTTATGAAAGAGG + Intergenic
910915887 1:92288341-92288363 TAGTAGGTGAATAATGAAAGTGG - Intronic
911341504 1:96644262-96644284 TAGGACAGGAAGAATGAAAAGGG - Intergenic
911728621 1:101268513-101268535 AGGCAGAGGAAATATGAAAGTGG + Intergenic
911911600 1:103644222-103644244 TAGGAGAATGATTATAAAAGAGG + Intergenic
911916854 1:103707728-103707750 TAGGAGAATGATTATAAAAGAGG - Intronic
911919015 1:103738360-103738382 TAGGAGAATGATTATAAAAGAGG + Intronic
911978556 1:104535185-104535207 TAAGAGAAGACATATGAAAGTGG + Intergenic
913126179 1:115792546-115792568 GAGGAAAAGAATTATGGAAGTGG - Intergenic
913278370 1:117161081-117161103 TGGGAGACGAATTATGAAAGAGG + Intronic
914963771 1:152233086-152233108 TTGAATAGGAATTGTGAAAGTGG + Intergenic
916268321 1:162914830-162914852 TCAGAGAGATATTATGAAAGGGG - Intergenic
916925324 1:169513396-169513418 AGGGAAAGGAATGATGAAAGGGG + Intergenic
917270286 1:173265202-173265224 AAAGAGACCAATTATGAAAGTGG + Intergenic
918648859 1:186934865-186934887 AAGGAGAGAAATTGTGGAAGTGG - Intronic
920994236 1:210972369-210972391 TTGGTCTGGAATTATGAAAGTGG - Intronic
921568612 1:216751511-216751533 CAGGAGAGAAATGATGAAAGGGG - Intronic
922377518 1:224983501-224983523 TTGGAGAGGAGTGATGAGAGTGG - Intronic
923904412 1:238367075-238367097 TTGAATAGGAATTGTGAAAGAGG + Intergenic
924049292 1:240064141-240064163 GAAAAGAGCAATTATGAAAGTGG + Intronic
1063761639 10:9085146-9085168 TAGAAGAGGAGTTGGGAAAGAGG + Intergenic
1064275724 10:13903243-13903265 TAGGAAAGGGATTAGGAACGGGG - Intronic
1064743410 10:18456144-18456166 AGGGAGAGGCATTATGAAAGTGG - Intronic
1067018731 10:42776617-42776639 TAGGGTAGGAAATATGTAAGAGG - Intergenic
1067512182 10:46905312-46905334 GTGGAGAGGCATGATGAAAGTGG - Intergenic
1067650062 10:48146510-48146532 GTGGAGAGGCATGATGAAAGTGG + Intergenic
1068911674 10:62384847-62384869 TTGGAGTGTAATTATGAAAGAGG + Intronic
1069485123 10:68817455-68817477 TAGGAGAGCACTGATGGAAGTGG + Intergenic
1069989220 10:72304258-72304280 TGGGACAGGAATCATGAAGGTGG - Intergenic
1074175918 10:111002356-111002378 TAGGCAAGAAATCATGAAAGTGG + Intronic
1074398557 10:113121265-113121287 TAGGAGAGGAAGGAAGGAAGAGG - Intronic
1074494212 10:113964893-113964915 TGGGAGAGGAAGTATGGAGGAGG + Intergenic
1076142045 10:128086970-128086992 GGGGAGAGGAATTAGGAAAAGGG - Intergenic
1076673363 10:132135229-132135251 TACGCAAGGAATTTTGAAAGTGG - Intronic
1078655118 11:13231451-13231473 AAGGAAAGGAATTCTGAAACAGG - Intergenic
1078660417 11:13281221-13281243 TAGGAGAGGAAGGATGGAAGAGG + Intronic
1079345342 11:19646932-19646954 TAGGAGAGGGAGTATGGGAGGGG - Intronic
1079966624 11:26988056-26988078 TAGGAAAGAAATTACAAAAGGGG + Intergenic
1080275620 11:30500284-30500306 GAGGAGAGGAAATATCAGAGAGG - Intronic
1080707969 11:34716630-34716652 TAGAAGAAGAATTAAGTAAGTGG + Intergenic
1081213658 11:40367563-40367585 TAGAAGGGGAATCATGAAAAGGG + Intronic
1082950297 11:58807705-58807727 TAGGACAGAAATGATCAAAGAGG - Intergenic
1083915407 11:65739956-65739978 TAAGCAAGGCATTATGAAAGTGG + Intergenic
1084917461 11:72439833-72439855 TAGGGGAGGAATGAGGGAAGAGG + Intergenic
1085626571 11:78078483-78078505 GAGGAGAGGAACTTTGGAAGAGG - Intronic
1085927092 11:81035449-81035471 TAGGGGAGGAATAATAACAGTGG - Intergenic
1086310552 11:85531555-85531577 CAGGAAAGGAGTTTTGAAAGAGG + Intronic
1086734413 11:90287800-90287822 TAGAAAAGGAATATTGAAAGTGG - Intergenic
1086849625 11:91794145-91794167 TAGGAGTGGGATTGTGCAAGTGG + Intergenic
1087279150 11:96191142-96191164 TAGTAGAGGAGTCATCAAAGGGG + Intronic
1088976027 11:114817252-114817274 CAGGACAGAAAATATGAAAGTGG + Intergenic
1089927413 11:122272978-122273000 TTGGAGACAATTTATGAAAGAGG + Intergenic
1090840440 11:130483011-130483033 AAGAGGAGGAGTTATGAAAGAGG + Intergenic
1090900925 11:131030392-131030414 AAGGGGAGTAATTATGAATGAGG + Intergenic
1093152062 12:15633719-15633741 GAGGAGAGGACTAAGGAAAGAGG - Intronic
1093216207 12:16364135-16364157 GAGCAGAGGAATTATGAACTGGG + Exonic
1093665207 12:21804224-21804246 TAGAAGAGAAATTAGGTAAGAGG + Intronic
1094046893 12:26177464-26177486 TGGGAGAGGAACTGTGAAGGTGG + Intronic
1094155175 12:27331682-27331704 TAAGACAGGAATTAAGAAAGAGG + Intergenic
1094246292 12:28298633-28298655 TAGAAGAAAAATTATGAAATTGG - Intronic
1094465135 12:30745068-30745090 TAGCAGTGGAATTACAAAAGAGG + Intronic
1095886611 12:47194873-47194895 AAGAAGAGGAATTATGAAACAGG - Intronic
1097470493 12:59984982-59985004 TTGAATAGGAGTTATGAAAGAGG - Intergenic
1099433676 12:82618957-82618979 GAGGAGAGGGATGAGGAAAGAGG + Intergenic
1100218197 12:92475683-92475705 TAGGGGAAGAATTTTAAAAGAGG + Intergenic
1100429310 12:94516308-94516330 TAGGAGCAGAACTATGAAAGGGG - Intergenic
1100766608 12:97872954-97872976 TAGGTGAGGACTAATAAAAGAGG - Intergenic
1103179817 12:118900521-118900543 GAGGTGGGAAATTATGAAAGAGG - Intergenic
1104231771 12:126891958-126891980 AAGGAGAGGGACTATGAAATGGG - Intergenic
1104688772 12:130808318-130808340 CAGGAGAGGAAGGAGGAAAGGGG - Intronic
1106277647 13:28228353-28228375 AAGGAGAGGAATTATAGATGTGG + Intronic
1106805077 13:33297985-33298007 TTTGAGAGGCATTTTGAAAGAGG - Intronic
1108073796 13:46657910-46657932 TTGGATAGGAAATAGGAAAGTGG + Intronic
1109333634 13:60964033-60964055 TAAAGGAGGAATAATGAAAGGGG + Intergenic
1109367970 13:61382397-61382419 AATGAGAGGGATTATGAAATGGG - Intergenic
1112387278 13:98951620-98951642 TAGGAAAGGAATTGAGACAGTGG + Intronic
1115093385 14:29605582-29605604 TAGGATAAGTGTTATGAAAGGGG - Intronic
1116371027 14:44132706-44132728 TAGGAGAGTCAATGTGAAAGTGG - Intergenic
1116505690 14:45677532-45677554 TAGGATAGGAACAAAGAAAGAGG - Intergenic
1117046915 14:51822210-51822232 TAGGAGAGGAATCACTAATGAGG + Intergenic
1117105549 14:52394337-52394359 TAGTAGTGGAATTAAGGAAGGGG - Intergenic
1119788322 14:77328746-77328768 GAGGAGAGGGAGTGTGAAAGAGG - Intronic
1119821751 14:77622328-77622350 TAGATTAGGAATAATGAAAGGGG - Intergenic
1121806060 14:96824499-96824521 TTAGAGAGGAATCATGAAGGCGG + Intronic
1122670719 14:103369690-103369712 TAGGATAGGAAATAATAAAGAGG - Intergenic
1124141663 15:27082497-27082519 TATGAGAGGAATCATGACAAGGG + Intronic
1124352158 15:28964029-28964051 TAGGTTAGGAATGATGGAAGAGG - Intronic
1125890321 15:43260779-43260801 TAGGAGAGGAAGGAAAAAAGAGG - Intronic
1126036942 15:44555403-44555425 GAGTAGAGAAAGTATGAAAGTGG - Intronic
1129224478 15:74160206-74160228 TAGAATAGGAATGATGAAACAGG - Intergenic
1131519231 15:93100734-93100756 GAGCAGAGGAATAATGTAAGTGG + Intergenic
1131761855 15:95632277-95632299 AAGGAAAGGAATTATGACACGGG - Intergenic
1133666665 16:7974786-7974808 GAGAAGAGGAATTTTAAAAGAGG - Intergenic
1133818931 16:9219302-9219324 TAAGGGTGGAATTATGACAGGGG + Intergenic
1134355751 16:13480550-13480572 TAGCAGAGGAAAAATGGAAGTGG - Intergenic
1135052891 16:19206769-19206791 TAGGACTGGATTTATGAAATGGG - Intronic
1135540541 16:23326889-23326911 TAGGAGAGGGGTTAGGAATGAGG - Intronic
1138986292 16:62332683-62332705 TAGGAAACAAATTATTAAAGAGG + Intergenic
1139111704 16:63899798-63899820 TAGTAGAGGAAAAATAAAAGGGG - Intergenic
1139116667 16:63962603-63962625 TTGGAGAGAAATTTTGAAAAAGG - Intergenic
1139728953 16:68926066-68926088 TAGAAGAGAAATTAAAAAAGAGG + Intronic
1140151323 16:72369920-72369942 TTGGAGTGGAATTATGAGTGAGG - Intergenic
1140421335 16:74821757-74821779 TAGGAGAGGGGATAGGAAAGGGG + Intergenic
1142776592 17:2144855-2144877 TAGGTGAGGAATGATGTAGGAGG - Intronic
1144082424 17:11776214-11776236 TAAGACAGGAATTCTGAAGGTGG + Intronic
1145229505 17:21162732-21162754 TTGGATAGGAGTTATCAAAGAGG + Intronic
1145935158 17:28711022-28711044 TAGGAGAGGAAGGAGGGAAGAGG + Intronic
1146575856 17:33990727-33990749 TGTGAGAAGAATTATGCAAGAGG + Intronic
1146742481 17:35298747-35298769 ATGGAGAGGACTTAGGAAAGTGG - Intergenic
1153140429 18:1966403-1966425 TAAGAAAGGCATTATAAAAGAGG + Intergenic
1155194588 18:23461497-23461519 TTGGAGTAGAATTATGGAAGAGG + Intronic
1155388251 18:25304712-25304734 TAGGAGAGGTCTTGTGGAAGAGG - Intronic
1155546808 18:26924188-26924210 TAGGAGAGGAACTAAGACAATGG + Intronic
1155614384 18:27704133-27704155 TAGTAGATGAATTATGAACAAGG + Intergenic
1155891835 18:31279826-31279848 GAGGAGAGGAAATGTGAAAGTGG - Intergenic
1156132090 18:33988506-33988528 GAGGAGAGTAACTATGAAAGAGG - Intronic
1156332905 18:36141575-36141597 AAGGAGAGAAATTTAGAAAGGGG + Intronic
1158217124 18:55111775-55111797 CAGGAGAGGGAGTAGGAAAGAGG + Intergenic
1159228151 18:65567888-65567910 AAGGAGAAGAATTAGGAAAGAGG + Intergenic
1159882418 18:73871111-73871133 TAGGAAAGGAATGAAGAAGGAGG + Intergenic
1160358649 18:78250867-78250889 TAGGAGAGGACTTTGGGAAGTGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1164912715 19:32025749-32025771 CAGGGGAAGAATTAGGAAAGAGG - Intergenic
1165172013 19:33900038-33900060 TAGGTGAGGAATTATGCTAAAGG - Intergenic
1166066863 19:40365207-40365229 TAGGAGAGGAGGGATGAGAGAGG + Intronic
1166754444 19:45181663-45181685 GAGGAGAGTAAATATGAATGCGG - Exonic
1167712193 19:51119221-51119243 TAGGAGAGGAAGCAAGAGAGAGG + Intergenic
1167987243 19:53329073-53329095 TAGGAGTGCAAGTTTGAAAGAGG + Intergenic
1168379973 19:55911960-55911982 TAATGGAGGAATTATTAAAGTGG - Exonic
925685308 2:6465573-6465595 AATGAGAGGAATTATTCAAGCGG + Intergenic
926606106 2:14899999-14900021 CAGGAGAGCAGTTATAAAAGGGG + Intergenic
928310826 2:30208142-30208164 AAGCAGAGGAATAATGACAGTGG + Intergenic
928937669 2:36696660-36696682 TGGGAGTGGAAATTTGAAAGAGG + Intergenic
929193665 2:39163583-39163605 GAGGAGATTAATTAGGAAAGAGG + Intergenic
930269570 2:49240481-49240503 TAGGAGAGACATTAGAAAAGGGG + Intergenic
931610256 2:64091132-64091154 TATAAGAGTAATTCTGAAAGTGG + Intergenic
931747296 2:65301286-65301308 GAGGCGAGGCATTCTGAAAGTGG + Intergenic
932450349 2:71806167-71806189 TAGGAGAGAAAACATGAAGGTGG + Intergenic
932470869 2:71955609-71955631 TTGGAAAGGAATGATGAAAGGGG + Intergenic
934032981 2:88065022-88065044 GAGGAGAGGAAATATTAAAAAGG - Intergenic
936919244 2:117670763-117670785 CAGGAGAGGAATGAGGAATGAGG + Intergenic
937974730 2:127575663-127575685 GAGGAGGGGATTTAAGAAAGGGG + Intronic
938600605 2:132834851-132834873 TTGAATAGGAGTTATGAAAGTGG + Intronic
938675748 2:133632154-133632176 TAGGGGAGGAATCATCAAACTGG + Intergenic
939076252 2:137606207-137606229 TAGGAGAGTGATGAGGAAAGAGG + Intronic
939380009 2:141423021-141423043 TATGACAGGAAATACGAAAGTGG + Intronic
939772900 2:146345422-146345444 ATGGAGAGGAGTTATAAAAGGGG + Intergenic
940281203 2:151991527-151991549 TAGGTGACGAATTCTGAAAATGG + Intronic
940709061 2:157140370-157140392 TTGCAGAGGAATTATGAGAGTGG + Intergenic
941089326 2:161156934-161156956 TAGGAAACTAATAATGAAAGGGG - Intronic
941151900 2:161925007-161925029 TAGGAGAGAAGTCTTGAAAGTGG + Intronic
941415408 2:165214663-165214685 TAAGAGAGGAATTTTGAATATGG + Intergenic
941610589 2:167656979-167657001 GAGGAGAGAAATCAGGAAAGAGG + Intergenic
941807455 2:169723420-169723442 TAAGAGAAGCCTTATGAAAGAGG + Intronic
942238929 2:173941009-173941031 GAGGAGAGAAAGTATGAAAGAGG - Intronic
943117877 2:183695676-183695698 AAGGAAAGGAATTAAGAAAGTGG - Intergenic
943217770 2:185060689-185060711 TTGAAGAGGCATTATGAAAGGGG - Intergenic
943779515 2:191806542-191806564 GAGGAGAGTGATTATAAAAGGGG - Intergenic
944131204 2:196349232-196349254 TACGAGAGGAAATAGGAATGAGG - Intronic
944326210 2:198407357-198407379 TAGGTGAGAAATTATGAAAAGGG + Intronic
945535256 2:211009466-211009488 TAGGAGAAAAATGATGGAAGTGG + Intergenic
945543743 2:211123071-211123093 TAGGAGAGGATTTTTAGAAGGGG + Intergenic
945702022 2:213183528-213183550 TAGTAGAGGAATGTTGACAGAGG - Intergenic
946668586 2:222077384-222077406 TAGGACTGAAATTAAGAAAGAGG - Intergenic
946673380 2:222130421-222130443 TATGAGACGAATAATGAATGTGG - Intergenic
947053146 2:226069889-226069911 TAGGAGAGAAATTTTAAATGTGG + Intergenic
947556259 2:231096015-231096037 TAGGGGAGGAATAATAACAGTGG + Intronic
1169000891 20:2167283-2167305 CAGGAAAGGAATGATGAAGGTGG - Intronic
1169136612 20:3201626-3201648 TAGGGGAGGCATTAGGAGAGAGG + Intronic
1169931685 20:10839801-10839823 GAGGAGAGAAATTAAGAAAAGGG - Intergenic
1173356244 20:42293536-42293558 TAGGATACAAATGATGAAAGAGG - Intronic
1173552967 20:43946212-43946234 TTGGAGAGGAATTCTGGAGGCGG + Intronic
1174364340 20:50047341-50047363 TAGGAAACTCATTATGAAAGAGG - Intergenic
1176939936 21:14911873-14911895 AAGGAGAGGAATGAGTAAAGGGG - Intergenic
1177043617 21:16143569-16143591 TTGGATAGGAATGATGAGAGAGG + Intergenic
1177170117 21:17645536-17645558 TAGTAGAAGAATTGTGAGAGAGG - Intergenic
1177371954 21:20216044-20216066 AAGCAAAGAAATTATGAAAGAGG - Intergenic
1178177169 21:30116397-30116419 CAGGTGAAGAATTCTGAAAGAGG + Intergenic
1179199462 21:39203073-39203095 TAGGCCAGGAATTATGAGAAAGG + Intronic
1182890227 22:33811974-33811996 TAAGAGAGGAACAAGGAAAGGGG + Intronic
1183709421 22:39493907-39493929 CAGGATAGGAATTTGGAAAGTGG - Intergenic
1184796217 22:46734684-46734706 TAGGAGAGGAATTAGTAGCGTGG + Intronic
1184890749 22:47377556-47377578 TAGGAGAGGATCCATGCAAGGGG + Intergenic
1184958494 22:47909902-47909924 AAGGAGAGGAAATAAGAATGAGG + Intergenic
949239503 3:1853062-1853084 TAGGAGAAAAACTCTGAAAGAGG - Intergenic
950503756 3:13380557-13380579 TAGGAGAGTGAATGTGAAAGTGG - Intronic
951826234 3:26872351-26872373 TAAGTGAGCTATTATGAAAGTGG + Intergenic
952511749 3:34065336-34065358 TTGCAGATGGATTATGAAAGTGG + Intergenic
952630751 3:35463441-35463463 TAGGAGATGCTTTAAGAAAGAGG - Intergenic
952716528 3:36485863-36485885 TCAGAGAGGAATAACGAAAGAGG + Intronic
953564440 3:44019238-44019260 TAGGAAAGCAAATAAGAAAGTGG + Intergenic
953856004 3:46499517-46499539 TGGGAAAGGAATTATGGGAGAGG - Intronic
954188429 3:48938606-48938628 GAGGAGAGAGATTATTAAAGGGG + Intronic
955975186 3:64473445-64473467 TAGGAAAGGGATTAGGAAGGAGG - Intergenic
957527979 3:81401707-81401729 TAGGAGAGGAAGTATTACGGTGG + Intergenic
958837547 3:99163205-99163227 AAGGAGAGGAATGAGTAAAGAGG + Intergenic
960749666 3:120933760-120933782 TATGGGAGGAACTATGATAGTGG + Intronic
960940444 3:122929682-122929704 GAGGAGAGCAATTAGGAAAGGGG - Intronic
961961771 3:130862873-130862895 TAGGAGTAGAATTGTGAAGGAGG + Intronic
962859152 3:139381599-139381621 ACTGAGATGAATTATGAAAGGGG + Intronic
963399740 3:144782810-144782832 TTTGAGAAGAATTATGAATGAGG + Intergenic
963908117 3:150791034-150791056 GAGGAGAGGAAAGCTGAAAGAGG - Intergenic
963908982 3:150798853-150798875 TAAGAGAGGAAATAGCAAAGGGG - Intergenic
964493227 3:157259559-157259581 TAGGATAGGAAATATAAAAGGGG - Intergenic
965998079 3:174911474-174911496 TAGAAGATGGATAATGAAAGAGG + Intronic
967255182 3:187584053-187584075 TTGAATAGGAATGATGAAAGAGG + Intergenic
967539481 3:190648701-190648723 TATGAAAGGAATAATGAAAAGGG + Intronic
967617615 3:191590987-191591009 TAGAAAAGGACTTATGAATGGGG + Intergenic
967836167 3:193964960-193964982 TTGGAGAGAAAATATGAAAATGG + Intergenic
968053471 3:195672908-195672930 TAGGAAAGTAATTATAAAATGGG - Intergenic
968102341 3:195975454-195975476 TAGGAAAGTAATTATAAAATGGG + Intergenic
969594046 4:8137990-8138012 AAGGAGAGGAATTCTGACACAGG + Intronic
970051791 4:11922853-11922875 TAGAAAAGGAATTATAAAAAAGG + Intergenic
971947524 4:33300531-33300553 GAGGTGAGTAATTATGACAGGGG - Intergenic
972119764 4:35685861-35685883 TAGGAGAGGAAGTCAGGAAGGGG - Intergenic
972867447 4:43251172-43251194 TGGGAGAAGAACTATAAAAGAGG + Intergenic
972925553 4:44002204-44002226 TGGGAAAGGAAATATGAAAAGGG - Intergenic
974596379 4:64018499-64018521 TGGGATAGAAATTAAGAAAGTGG - Intergenic
974609142 4:64192788-64192810 AAGGAGAGGAAAGATTAAAGAGG - Intergenic
975257038 4:72249390-72249412 TTGGAGAGATATTTTGAAAGTGG - Intergenic
976163682 4:82230761-82230783 TAGGAGAATGAATATGAAAGTGG - Intergenic
976176462 4:82358325-82358347 TAGGAAAGGAATTAAGAATAGGG - Intronic
976751364 4:88453707-88453729 AAGGAGTGAATTTATGAAAGTGG - Intergenic
976787124 4:88834356-88834378 TTGGTGAGGAAATATGTAAGTGG + Intronic
977127211 4:93185016-93185038 TAGGAGAGTCATTTTGAAAATGG + Intronic
977802872 4:101259145-101259167 CTGGAGAGGAATGATGATAGAGG - Intronic
978091209 4:104718143-104718165 TAGAAAAGGAATTATGAGAAAGG - Intergenic
979153719 4:117355478-117355500 TAGGAGAAGAAATGTGAAAAAGG + Intergenic
979927661 4:126587823-126587845 TTGAATAGGAATTGTGAAAGTGG - Intergenic
980767583 4:137327900-137327922 TAGAATAGGAATGGTGAAAGTGG + Intergenic
981172585 4:141642226-141642248 GAGAAGGGTAATTATGAAAGAGG + Intronic
981208307 4:142070440-142070462 TTGAAGAGGAATGGTGAAAGAGG - Intronic
981249860 4:142586758-142586780 AAGGAGAGAATTAATGAAAGGGG + Intronic
982027091 4:151261683-151261705 TAGCAGAAGAAATATGAAAGAGG - Intronic
982308899 4:153963284-153963306 AAGGAGAGGAACAATGAAAGAGG - Intergenic
982418662 4:155167486-155167508 GAGGACAGGAATAAGGAAAGTGG - Intergenic
983057324 4:163113330-163113352 TAGGAGAGGAATTATGAAAGTGG - Intronic
983901223 4:173136716-173136738 TATGAGTGGAATAATGAAGGGGG - Intergenic
983965318 4:173802258-173802280 AAGGAGAGGGATTGTGAAGGTGG + Intergenic
984062951 4:175014523-175014545 CAGGAGGGGAATTTGGAAAGAGG + Intergenic
984149808 4:176113201-176113223 TAGGAGAGAAATTGTGTAGGTGG - Intronic
987156293 5:15092870-15092892 TAGGGCAGTAATTATGGAAGAGG + Intergenic
987704751 5:21447916-21447938 TTGAATAGAAATTATGAAAGTGG + Intergenic
989028123 5:37089392-37089414 TAGGGGAGGAATAATAACAGTGG - Intergenic
991430719 5:66542037-66542059 TAGTAGTGGAATTATAGAAGTGG + Intergenic
992272818 5:75083322-75083344 TAGGAGTGGAATTATTATACAGG - Intronic
992936266 5:81709387-81709409 TAGAAGAGAAAGTAGGAAAGGGG - Intronic
993025805 5:82644592-82644614 TCTCAGAGGAATTATGAAATTGG + Intergenic
995023763 5:107396162-107396184 AAGGAGAATAATAATGAAAGGGG - Intronic
995237061 5:109841091-109841113 AAAGAGAGCAATTAGGAAAGTGG - Intronic
995302815 5:110604050-110604072 TAGGTAAGCAATTATGATAGTGG - Intronic
995714201 5:115066140-115066162 TTGGGGAGGATTTATGAGAGTGG - Intergenic
997047794 5:130340202-130340224 TAGGAAAGGGATGAAGAAAGAGG + Intergenic
998651471 5:144125843-144125865 TGGGAGAGGAATTCTGAAGGGGG + Intergenic
999363566 5:151006494-151006516 TAGGAGAGGAAGGAGGAAAGAGG - Intergenic
1000209297 5:159096078-159096100 AAGGGGAGGAAGAATGAAAGTGG + Intronic
1000294444 5:159900928-159900950 TTTGAGAAGAATAATGAAAGAGG + Intergenic
1000594483 5:163198506-163198528 TAGGAGAGTATTCATGATAGAGG + Intergenic
1000815078 5:165910972-165910994 CAGGAAAGGAATGATGACAGTGG + Intergenic
1003335884 6:5171867-5171889 TACGGGAAGAATTATGAATGGGG + Intronic
1003722699 6:8722109-8722131 AAGGAGATGAATTGTGTAAGGGG + Intergenic
1005800733 6:29420446-29420468 TTGAAGAGAAATTGTGAAAGTGG - Intronic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006236218 6:32635496-32635518 TTGGGGAGGATTTAAGAAAGAGG + Intronic
1006280886 6:33052047-33052069 TAGGGGAGGAATAATAACAGTGG - Intergenic
1007662913 6:43497336-43497358 TAGGAGAAGAAATCTGAAAAGGG - Intronic
1009786431 6:68346041-68346063 TATGAGAGGCATTATCGAAGAGG - Intergenic
1009790037 6:68390901-68390923 AAGAAAAGGAATTATGAAAAGGG - Intergenic
1010567453 6:77433146-77433168 AAGAAGAGGAAATAAGAAAGAGG - Intergenic
1011073181 6:83408346-83408368 TGGGAGAGGAATGTTGAAACAGG - Intronic
1012179344 6:96131843-96131865 GTGGAGAGGAATTAGGGAAGGGG + Intronic
1012714033 6:102646514-102646536 AAGCAGAGGAAAAATGAAAGGGG + Intergenic
1014172904 6:118298598-118298620 TCGGAGAGGACTTATTGAAGTGG - Intronic
1014473940 6:121849673-121849695 AAGGAGAGGAATACTGAATGAGG - Intergenic
1014886050 6:126782667-126782689 TATGACAGGTAATATGAAAGAGG + Intergenic
1016179142 6:141122137-141122159 TAGTAGTGGAGTTATGAAAATGG + Intergenic
1016309295 6:142715969-142715991 ATGAAGAGTAATTATGAAAGTGG + Intergenic
1016327492 6:142919615-142919637 TAAGAGAATAATTATAAAAGTGG - Intronic
1016900978 6:149101865-149101887 TTGAATAAGAATTATGAAAGTGG - Intergenic
1020642015 7:10767404-10767426 TATAATAGCAATTATGAAAGCGG - Intergenic
1020667597 7:11067807-11067829 TAAGAGAGGAATCAAGAGAGGGG + Intronic
1020753589 7:12172237-12172259 TAGGGGAGGAATCTTTAAAGGGG - Intergenic
1021575901 7:22105630-22105652 TAGGTGAGGAATGATGATTGGGG - Intergenic
1023679701 7:42673022-42673044 TAGGACTGAAAATATGAAAGAGG - Intergenic
1024187062 7:46960529-46960551 TAGGAGAGGTGCTATGAAAATGG - Intergenic
1024825590 7:53386325-53386347 TAGAAGATGAATTATGAACATGG - Intergenic
1025950722 7:66143310-66143332 TAGGAGAGCAATCAAGGAAGAGG - Intronic
1027136489 7:75628035-75628057 TTGGATAAGAATTGTGAAAGAGG - Intronic
1028022366 7:85792492-85792514 GAGGAGAGGAAATAATAAAGAGG + Intergenic
1029466807 7:100730646-100730668 TAGCAGAGGAATTAACAGAGGGG - Intergenic
1030621848 7:111798540-111798562 TAGTAGAGCTATTATGACAGTGG - Intronic
1033296663 7:140144591-140144613 GAGGAAAGGAAATATAAAAGGGG + Intronic
1033851371 7:145499641-145499663 TAGAAGAAAAATTAGGAAAGAGG + Intergenic
1035195290 7:157214197-157214219 TAGGATAGGAAATATGAAAGAGG + Intronic
1035925586 8:3724575-3724597 TGGGAGAGGAATTAGGGAGGGGG + Intronic
1036385384 8:8274804-8274826 CAGTAGAGGAATTAAGAAAATGG + Intergenic
1037359371 8:18056842-18056864 AAGTAGAGTAATTATGAAAAAGG + Exonic
1037809318 8:22077218-22077240 TAGGAGGGGAATGAAGAAACTGG + Intronic
1038322377 8:26539325-26539347 TGGGAAAGGAATTGTGAAACTGG - Intronic
1043072373 8:75654955-75654977 TAGAAGATGCATTTTGAAAGTGG + Intergenic
1043788641 8:84434270-84434292 TTGGAGATGGATTATAAAAGGGG - Intronic
1044149801 8:88761412-88761434 TAGGACAGGAAAAATGAAACAGG + Intergenic
1044330254 8:90911252-90911274 TAGGAGAGAAAGGAAGAAAGAGG + Intronic
1044710344 8:95051325-95051347 GAGGAGAAGATTTAAGAAAGAGG + Intronic
1045750268 8:105475878-105475900 GAGGAGACAAATTAAGAAAGTGG + Intronic
1046090037 8:109491279-109491301 TAGGAGCTGAATTATGACTGAGG + Intronic
1046096121 8:109563430-109563452 TAGGAGTGGGATGATGAAACAGG - Intronic
1047242287 8:123101757-123101779 AAGGATAGCAATTATGGAAGTGG - Intronic
1047655681 8:126974364-126974386 TATGAGAAGAATTTGGAAAGAGG + Intergenic
1049054481 8:140224776-140224798 TAGGGGAGGCATTATGGAAGAGG - Intronic
1050107389 9:2179378-2179400 TAGGAGAGGAAAAAAGAAAGTGG + Intronic
1050426149 9:5514896-5514918 CAGGGGAGGATTTATGAAGGAGG + Intronic
1050441809 9:5671715-5671737 GAGGAGAGGAGTTAGGAATGGGG - Intronic
1050949264 9:11567192-11567214 GAGGAGAGGAAAGATTAAAGAGG - Intergenic
1051143454 9:14002859-14002881 GAGGAGAGGAAATATGAGTGAGG + Intergenic
1051395651 9:16617397-16617419 TATGAAAAGAATTATGAAAATGG + Intronic
1051546148 9:18278044-18278066 TAGGGGAAGAATAATTAAAGTGG - Intergenic
1052721853 9:32181305-32181327 TGGCAGAGGAATTATGAAATGGG - Intergenic
1052805818 9:33012383-33012405 AAGGGTAGGAATTCTGAAAGGGG - Intronic
1053055778 9:34992322-34992344 TAGGAGAGGTATTAAGGAAATGG + Intronic
1053092951 9:35296488-35296510 TAGGAAGGGAATTATGAAACAGG - Intronic
1054871848 9:70054371-70054393 TATGAGAAGAATTAGGAAAGTGG + Intronic
1055164808 9:73178324-73178346 GATGAGCGGACTTATGAAAGAGG + Intergenic
1058533084 9:105926161-105926183 GAGGAGATGAATTTTGAAATGGG + Intergenic
1058664728 9:107301421-107301443 TGGGCAAGGAAATATGAAAGAGG - Intronic
1059380901 9:113923329-113923351 TTGAATAGGAATTATGAGAGAGG + Intronic
1059438915 9:114291849-114291871 GAGGAGAGGAATTGTGGGAGAGG + Intronic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1060131997 9:121110725-121110747 TAGGAGAGCAAATTTGAATGTGG + Intronic
1189533739 X:41914517-41914539 TGGGAGAAGAAATGTGAAAGAGG + Intronic
1190846243 X:54193855-54193877 TAGAAGAGGAATCAGAAAAGGGG - Exonic
1191773221 X:64784924-64784946 TAGGGGAGGAATTACAACAGTGG + Intergenic
1192614771 X:72608317-72608339 GAGGAGAGGAAATAGTAAAGAGG - Intronic
1193141477 X:78031904-78031926 GGAGAGAGGAATTATGGAAGGGG - Intronic
1193897019 X:87127129-87127151 AAGGAGAGGAAATAGTAAAGGGG + Intergenic
1195601284 X:106751629-106751651 GAGGAGAGGAAAGATTAAAGTGG + Intronic
1197143691 X:123146549-123146571 GAGGAGAGGGATGAGGAAAGGGG - Intergenic
1197799855 X:130337926-130337948 TAGGAGAGTAATTTAGAAAATGG - Intergenic
1198552173 X:137756682-137756704 GAGGATAGGAAGTATGAATGGGG + Intergenic
1198674500 X:139117859-139117881 TATGTGAGGAAGCATGAAAGAGG - Intronic
1202085520 Y:21132845-21132867 TAGGAGAGGAAACAAGAGAGAGG + Intergenic