ID: 983057998

View in Genome Browser
Species Human (GRCh38)
Location 4:163122340-163122362
Sequence CAGAACAAAAAGAAGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 5, 3: 88, 4: 737}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983057996_983057998 4 Left 983057996 4:163122313-163122335 CCAGCTCTAAACAATCAACAAAA 0: 1
1: 0
2: 3
3: 41
4: 1047
Right 983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG 0: 1
1: 0
2: 5
3: 88
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983057998 Original CRISPR CAGAACAAAAAGAAGTGGAG AGG Intronic
900839880 1:5039928-5039950 CAGAAGGAGAAGAAGGGGAGAGG - Intergenic
902233557 1:15043622-15043644 AAAAAAAAAAAGAAGTGGGGAGG - Intronic
903455940 1:23486829-23486851 AAAAACAAAAAGAAGAGGGGTGG - Intergenic
903766497 1:25738294-25738316 CAGACCAGATAGAAATGGAGAGG + Intronic
903772997 1:25775845-25775867 CAAAACAAAAAAAACTGGGGTGG - Intronic
904117507 1:28173653-28173675 AAGAAAAAAAAAAAGAGGAGGGG + Intronic
904461264 1:30681407-30681429 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
905319082 1:37103004-37103026 AAGAACAGAAAGAAAAGGAGAGG + Intergenic
905587226 1:39130052-39130074 CAGAGAAAAAAAAAATGGAGTGG - Intronic
906011736 1:42533335-42533357 AAGAAGAAAGAGAGGTGGAGGGG + Intronic
906564443 1:46788517-46788539 CAGAACAACTTGAAGTGGGGAGG + Intronic
906772156 1:48494797-48494819 AAGACCACAAAGAGGTGGAGTGG - Intergenic
907396403 1:54193393-54193415 GAGATCAGAAAGAAGTGAAGGGG + Intronic
907601778 1:55779099-55779121 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
907900952 1:58741006-58741028 GGGAACAGAAAGAAGGGGAGAGG + Intergenic
908203801 1:61824359-61824381 CAAAAAAAAAAAAAGTGGACCGG - Intronic
908581684 1:65523919-65523941 TACAACAAAAAGAAGAGAAGAGG + Intronic
909582959 1:77258758-77258780 AAAAGCAAAAAGTAGTGGAGAGG + Intergenic
910199552 1:84684960-84684982 CAGAGGAAAAAGGAATGGAGGGG + Intronic
910285047 1:85544631-85544653 CAGTACTAAATAAAGTGGAGAGG + Intronic
911115186 1:94238809-94238831 CAGAACCAAAAGTAGGGTAGCGG + Intronic
912017451 1:105059955-105059977 TAGAACAGAAAGAAAGGGAGAGG + Intergenic
912186681 1:107285154-107285176 CAGAATAACACGAAGTAGAGTGG + Intronic
912913124 1:113783274-113783296 AAGAAAAAAAAGGGGTGGAGGGG + Intronic
913495440 1:119424067-119424089 AAGAAAAAAAAAAAATGGAGGGG + Intergenic
913574955 1:120163055-120163077 AAAGACAAAAAGAAGTGGAATGG + Intronic
914095147 1:144538891-144538913 CAAAACAAAAAGTAGGGGAGGGG + Intergenic
914259747 1:145988927-145988949 CAAGGCAAAAAGAAGTAGAGTGG + Intergenic
914296219 1:146327896-146327918 AAAGACAAAAAGAAGTGGAATGG + Intergenic
914303376 1:146395005-146395027 CAAAACAAAAAGTAGGGGAGGGG - Intergenic
914516365 1:148378175-148378197 CAAAACAAAAAGTACGGGAGGGG + Intergenic
914557261 1:148778686-148778708 AAAGACAAAAAGAAGTGGAATGG + Intergenic
914615573 1:149351544-149351566 AAAGACAAAAAGAAGTGGAATGG - Intergenic
914728566 1:150350194-150350216 AAAAAAAAAAAGAAATGGAGGGG - Intronic
915193523 1:154171927-154171949 CTCAACAAAATCAAGTGGAGGGG + Intronic
915401052 1:155622148-155622170 CAGAAAAAGAAAAAGGGGAGGGG - Intergenic
915601669 1:156926570-156926592 CAAAAAAAAAAGAAGAGGTGGGG - Intronic
915900111 1:159840665-159840687 CAGAAGGACAAGAAGTGCAGGGG + Intronic
916018758 1:160775135-160775157 CAGAAAGAAAACAAGGGGAGTGG + Intergenic
916088179 1:161286330-161286352 CAGAACAAAAACAATTGAAAAGG - Intergenic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
917344501 1:174015360-174015382 CAAAAAAAAAAAAAGTGTAGTGG - Intronic
917402993 1:174672455-174672477 CAGACCAAAAATAAATGGAATGG - Intronic
917745161 1:177999616-177999638 CAGAACAAAAGGAAAGGAAGGGG + Intergenic
918135546 1:181670759-181670781 CAGCACAAAAGGTAGTGGGGTGG - Intronic
918179423 1:182073360-182073382 CAGAAGAGATAGAAGAGGAGTGG - Intergenic
918762032 1:188422005-188422027 CACAAGACAAAGAAGTGGAGAGG + Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919078638 1:192842714-192842736 CAGAACAAAAGCGAGTGGGGAGG + Intergenic
919754559 1:201058702-201058724 CAGAGCAGAAAGTAGTGGTGGGG + Intronic
920353940 1:205356573-205356595 CAAAAGACAAAGAAGGGGAGGGG + Intronic
920609991 1:207426552-207426574 AAAAAAAAAAAGAAGGGGAGGGG + Intergenic
920805361 1:209228751-209228773 CAGAACTAAATGAAATGGATTGG + Intergenic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921251863 1:213305617-213305639 CAGAACACAGAGTAGAGGAGTGG + Intergenic
921662579 1:217822992-217823014 CATAACAAAAAGAAGGGAACAGG - Intronic
921691844 1:218160647-218160669 CAGAAGGAAGAGAAGTGGAGAGG - Intergenic
922651943 1:227348229-227348251 TAGAAGAAAGAGAAGAGGAGAGG - Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
923156773 1:231285984-231286006 CAAAAAAAAAAGAAGTGGGATGG + Intergenic
924313509 1:242772400-242772422 CATTACAAAAAGAAGTTTAGGGG - Intergenic
924734839 1:246746543-246746565 AAGAATAAAAAGAAGTGGCTAGG + Intronic
924736133 1:246757889-246757911 CAGAAAAAAAAGGATTAGAGTGG + Intronic
924945691 1:248845365-248845387 CACCAAAAAAAAAAGTGGAGTGG + Intronic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1063617121 10:7610042-7610064 AAGAAAAAAAAGAAAGGGAGGGG - Intronic
1064930662 10:20622230-20622252 TAGAACAAAAATAAGTGGATTGG - Intergenic
1065386417 10:25138118-25138140 CAGAAAAAAAAGCAGGGGAAAGG + Intergenic
1065827614 10:29586190-29586212 GAGAACAAAAAGGAGAGGGGAGG + Intronic
1066192551 10:33069338-33069360 CAGAACAAGAAGAAAAGGAGAGG - Intergenic
1066652697 10:37673625-37673647 CTGAATAAATAGGAGTGGAGTGG + Intergenic
1066841828 10:39931663-39931685 CAGAACACAAAGAAGTGACTGGG - Intergenic
1067277984 10:44851382-44851404 TTGAAAAACAAGAAGTGGAGAGG + Intergenic
1067532099 10:47081406-47081428 CAGAAGAGAAAGAAGGGGCGGGG - Intergenic
1067949358 10:50714840-50714862 AAGAACAAAAAAATGTGTAGTGG + Intergenic
1068364222 10:56024432-56024454 CAAAACAAAAATAAGTCAAGAGG + Intergenic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1068952542 10:62791430-62791452 CAAACCAAAAAGAGGTGAAGCGG - Intergenic
1069525213 10:69164214-69164236 CAAAAAAAAAAAAGGTGGAGGGG - Intronic
1069530070 10:69211152-69211174 CAGGAAAAATAGAATTGGAGTGG + Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070507817 10:77130701-77130723 AAGAACAAAAAGAATGGAAGAGG + Intronic
1070585725 10:77764425-77764447 GAAACCAAAAAGTAGTGGAGAGG + Intergenic
1070804005 10:79259965-79259987 CAGACCAACAAAAAGTCGAGGGG - Intronic
1070884670 10:79879857-79879879 AAGAACAAAAAAATGTGTAGTGG + Intergenic
1071177765 10:82946215-82946237 AAAAAAAAAAAAAAGTGGAGTGG + Intronic
1071291777 10:84194242-84194264 CAGAAGAAAAGTTAGTGGAGCGG - Intergenic
1071367693 10:84916636-84916658 CAGAAGAACAAGAAGTGCAGTGG + Intergenic
1071437794 10:85662916-85662938 CAGAACATAAAGTATCGGAGCGG - Intronic
1072868427 10:99089183-99089205 CAAAACAAAAATAAATGGATGGG - Intronic
1072906065 10:99455061-99455083 CAGAATATAAAGAATTGAAGAGG + Intergenic
1074119361 10:110481909-110481931 AAGACCAGAAAGAAGTGCAGGGG - Intergenic
1074452134 10:113567914-113567936 TCGCACAAAAAGAGGTGGAGCGG - Intronic
1074571599 10:114629391-114629413 GAGAACAAGAATAAATGGAGAGG + Intronic
1074650352 10:115515932-115515954 CTTAAAAAAAAGAAGTGGAAAGG - Intronic
1075086525 10:119417742-119417764 GAGGACAAAAAGGAGGGGAGAGG + Intronic
1078069601 11:8099692-8099714 AAGAAGAAAAAGTAGGGGAGGGG + Intronic
1078113492 11:8420980-8421002 CTGAAAAAAAAAAAGGGGAGGGG + Intronic
1080260600 11:30345810-30345832 AACAACAAAAAGAAGTGTACTGG + Intergenic
1080321026 11:31009664-31009686 TAGAACAAAAAGCAGAGGAGAGG - Intronic
1080780068 11:35420803-35420825 GAGAACTAAATGAAATGGAGAGG + Intergenic
1080922288 11:36721131-36721153 AAGAAGAAAAAGAAGTATAGAGG - Intergenic
1080951318 11:37036455-37036477 CAGAACAGAGAGAGGTGGAGAGG + Intergenic
1081605019 11:44521694-44521716 CAGCACAAAAGGATGTAGAGGGG - Intergenic
1081824233 11:46031953-46031975 GAGAACAAAAAGATGTGCATTGG - Intronic
1082171719 11:49012838-49012860 CAGAAACAAAAGAAATGGAGTGG - Intergenic
1082866326 11:57903033-57903055 CAGAACAACTTGAAGTGGGGTGG + Intergenic
1082949406 11:58794883-58794905 CACAACAAACAGAACTTGAGGGG + Intergenic
1083264359 11:61539487-61539509 CAGAACAAAAGGAGAGGGAGGGG + Intronic
1083646877 11:64176810-64176832 CAGAAAAAAAAGGGGTGGGGGGG + Intergenic
1083743338 11:64722512-64722534 GAGAAGAGAGAGAAGTGGAGAGG - Intronic
1085502645 11:77037947-77037969 AAGAAGAAGAAGAAGAGGAGGGG + Intronic
1085573494 11:77581252-77581274 CACAACAAACAGAACTTGAGGGG - Intronic
1085751572 11:79166935-79166957 TAGAACATAAAGCAGGGGAGTGG + Intronic
1085878100 11:80433181-80433203 AAGAGCAAAAATAAGTAGAGAGG - Intergenic
1086095078 11:83042070-83042092 CTGAACAAATAGTAGAGGAGTGG - Intronic
1086145226 11:83544432-83544454 AACAACAAAAAAAAGTGGGGAGG - Intronic
1086186682 11:84025906-84025928 AAGAAAAAAGAGAAGAGGAGAGG + Intronic
1086694050 11:89823111-89823133 CAGAAATAAAAGAAATGGAGTGG + Intergenic
1086712097 11:90021458-90021480 CAGAAATAAAATAAATGGAGTGG - Intergenic
1087215157 11:95485774-95485796 CAGAACAAAAAGCTGTGGATTGG + Intergenic
1087245109 11:95826096-95826118 CAGAGGCAGAAGAAGTGGAGGGG - Intronic
1087375254 11:97331782-97331804 CTGAAAATATAGAAGTGGAGGGG - Intergenic
1088170978 11:106996241-106996263 CATAGGAAAAAGAAGGGGAGGGG + Intronic
1088200263 11:107324723-107324745 CAGTACATAAATAAGTGGATTGG + Intergenic
1088360798 11:108987058-108987080 GGGAAGAAAATGAAGTGGAGAGG + Intergenic
1089001994 11:115059867-115059889 CAGTACAAACAGTAGTGGAGGGG + Intergenic
1089430283 11:118417967-118417989 CAGTACAAAATGAAATGAAGTGG + Intronic
1089485848 11:118845541-118845563 CAGATCTAAAAGAGGTGGAAGGG - Intergenic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1089997179 11:122919366-122919388 AAAAAAAAAAAGAAGTGAAGGGG + Intronic
1090814278 11:130277515-130277537 CAGCACAAAAATAAGTGGGTAGG - Intronic
1091067743 11:132532335-132532357 CAGCAGAAAAGGAAGTGCAGAGG + Intronic
1092196514 12:6552791-6552813 AAGAACAAATAGAACTGTAGTGG - Intronic
1092251994 12:6904764-6904786 GAGGACAAAAAGAAGTGGGCAGG - Intronic
1092257164 12:6933485-6933507 AGGAACATAAAGAAATGGAGCGG - Intronic
1093122483 12:15288998-15289020 ATGAACAAAAAGAAATAGAGTGG + Intronic
1093305461 12:17512252-17512274 CAGAAGGAAAAGAAGTGAAATGG - Intergenic
1093708295 12:22299858-22299880 CACAACAAACAGAACTTGAGGGG - Intronic
1093865783 12:24226022-24226044 AAGAACAAAGAGAAGTGAAGGGG - Intergenic
1094347745 12:29489398-29489420 CCGAAATAAAAGAAGTGTAGGGG + Intronic
1094655500 12:32416008-32416030 CACAACACAAAGACATGGAGAGG - Intronic
1095658674 12:44702023-44702045 CAGAAGAATAAAAAGTGGAAAGG - Intronic
1095904997 12:47368642-47368664 GAAAAGAAAGAGAAGTGGAGGGG + Intergenic
1096117862 12:49066188-49066210 CAGAGCAAAAGGAAGTGAAATGG - Intronic
1096332051 12:50722206-50722228 CAGAACAATATGAAGTGTGGGGG - Intronic
1096373157 12:51084977-51084999 CAGAACAAAATGAGGGGGCGGGG - Intergenic
1096879420 12:54655332-54655354 CAGAACAGGAAGAAGGGAAGTGG - Intergenic
1098450712 12:70615485-70615507 CAAAATAAAAAGTAGGGGAGGGG - Intronic
1099569834 12:84303215-84303237 CAGAAAAAAAACAAAAGGAGTGG + Intergenic
1100112777 12:91265614-91265636 CAGAAAAAAAAGAAATGAAAAGG + Intergenic
1100406828 12:94279134-94279156 AAGAAAAAAAAGAATTGGAAGGG - Intronic
1101008889 12:100429936-100429958 CAGAAGAAAGAGAAGGGAAGAGG - Intergenic
1101064541 12:101005964-101005986 CACAACCAAGAGAAATGGAGAGG - Intronic
1102658301 12:114502367-114502389 CAGAGCAAAGAATAGTGGAGTGG + Intergenic
1103625944 12:122219865-122219887 CAAAAAAAAAAAAAGTGGATGGG + Intronic
1103632881 12:122276956-122276978 CAGAAAAAAAAAAGGTGGGGTGG - Intronic
1103638398 12:122328276-122328298 AAGAAAAGAAAGAATTGGAGAGG - Exonic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1104624674 12:130341243-130341265 CAGAACCAAAAGACGTCCAGTGG - Intronic
1105712705 13:23028375-23028397 CAGGAGAAAAAGAAGTGGGTTGG + Intergenic
1106895585 13:34297995-34298017 CATAACAAAAAGTAGAAGAGTGG - Intergenic
1106929330 13:34646927-34646949 GAGAACAGAAAGAAAAGGAGAGG + Intergenic
1107881663 13:44837382-44837404 CAGAAAACAAAGCAGTGAAGAGG - Intergenic
1107910798 13:45104104-45104126 CAGAACAAAACAAAATGGGGAGG - Intergenic
1108369365 13:49752309-49752331 CAGAAGAAAAAGATCTTGAGTGG + Intronic
1108421981 13:50260170-50260192 AAAAAAAAAAAAAAGTGGAGGGG - Intronic
1109048135 13:57439684-57439706 AAGATTAAAAAGAAGTGGAGAGG + Intergenic
1109802087 13:67393779-67393801 CAGAAATAAAAAAAGTGGAAAGG - Intergenic
1109907825 13:68868066-68868088 CAGAACTAAATGAAGTTGAGGGG + Intergenic
1110077556 13:71267796-71267818 CAAAACAAAAGGAGGTGGGGGGG + Intergenic
1110219014 13:73053198-73053220 CAGAGTAAAAATAAGTGTAGAGG + Intergenic
1110360510 13:74619857-74619879 CAGAACATAAAGAGATGAAGTGG - Intergenic
1110502640 13:76246719-76246741 AAGAAGAAAAAGAAGGGGAAGGG - Intergenic
1111734182 13:92116096-92116118 CAGAAAAAAAATAAGTGTGGTGG + Intronic
1112049889 13:95634987-95635009 AGGAAAAAAAAGAGGTGGAGGGG - Intronic
1112584509 13:100706305-100706327 AAGAAGAAAGAGAAGGGGAGAGG - Intergenic
1112838540 13:103546978-103547000 ATGAAGAAAAAGAAGAGGAGAGG + Intergenic
1113350343 13:109523516-109523538 CAGACGAAAAACAAGTGGAGAGG + Intergenic
1113501018 13:110774362-110774384 AAACAAAAAAAGAAGTGGAGGGG - Intergenic
1114255836 14:21000823-21000845 CAGAACACAAAAAAGGGTAGGGG - Intronic
1115100277 14:29690132-29690154 AAAAACAAAAAGAAGAAGAGAGG + Intronic
1115315449 14:32020545-32020567 CAGAAGAAACAGAAGTGCACTGG + Intergenic
1115361816 14:32511696-32511718 CCGAACAAAAAGAACTGGTATGG - Intronic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1116434630 14:44882850-44882872 CAGAAAAGAAAGAAATGAAGGGG + Intergenic
1116525981 14:45905832-45905854 CAGAAGGAAAAGAAATGGAAAGG + Intergenic
1117375544 14:55115385-55115407 AAGAACAAAAAAACGTGGTGAGG + Intergenic
1117561492 14:56944310-56944332 AAGAACAAAGAGAAGTGAAGAGG - Intergenic
1117950262 14:61075851-61075873 CAAAAAAAAAGGAAGTTGAGTGG - Intronic
1118474977 14:66108327-66108349 CAGAAAGAAAAGAGGTAGAGAGG + Intergenic
1118545332 14:66880336-66880358 AACAACAAAAAGAAGTGAAGTGG - Intronic
1118658125 14:67976072-67976094 GAAAACAAAAACAACTGGAGTGG - Intronic
1118832791 14:69450334-69450356 CAAAACACATAGAAGTGAAGTGG - Intronic
1119188043 14:72658596-72658618 CAGAGGAAAAAGAAATGGATAGG + Intronic
1119445395 14:74659229-74659251 AAAAAAAAAAAAAAGTGGAGAGG - Intronic
1119537198 14:75412219-75412241 CGTACCAAAAAGAAGTGGCGTGG + Intergenic
1120116194 14:80620145-80620167 CAAAACAAAAACAAGTGCACTGG + Intronic
1120835373 14:89034389-89034411 CAGAACAGAAAGAAATGCAGAGG - Intergenic
1120984833 14:90325522-90325544 CAGAACAAAAAAAAGCAAAGAGG - Intronic
1121097027 14:91224645-91224667 CAGAAATAGAAGGAGTGGAGGGG - Intronic
1121280858 14:92696706-92696728 AAGAAAAGAAAGAAGAGGAGAGG + Intergenic
1121347098 14:93144239-93144261 CAAAACAAAAAGAAGGGGGTTGG + Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122187180 14:100008553-100008575 CAGAAGAAAAAGAAGGGTAAAGG - Intronic
1122329017 14:100900580-100900602 CACAGCAAAAAGGAGTGTAGGGG + Intergenic
1122621340 14:103059008-103059030 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122665946 14:103329663-103329685 AAGAAAAAAAAAAAGTTGAGAGG + Intergenic
1122926229 14:104903325-104903347 CAGCACAAAAAGTGGGGGAGAGG - Intergenic
1123228925 15:17081304-17081326 CAGAACAGAAAGAAGTACAGTGG + Intergenic
1123488533 15:20762272-20762294 CAGATCAAAAAAAAGTGATGTGG - Intergenic
1123545030 15:21331345-21331367 CAGATCAAAAAAAAGTGATGTGG - Intergenic
1123634627 15:22291472-22291494 CACATCAATAAGAAGTGGATAGG + Intergenic
1123685331 15:22792960-22792982 AAGAACAAAAAGAATTGGGTTGG + Intronic
1124108077 15:26759681-26759703 CAGATCAAAAGGAAGAGGACAGG - Intronic
1125570825 15:40716646-40716668 AAAAAAAAAAAGAAGTAGAGAGG - Intronic
1126634595 15:50768271-50768293 CAAAACAAAAAGAAAAGGAGGGG - Intergenic
1126698412 15:51345134-51345156 GAGAACAAAAAGAATATGAGAGG - Intronic
1127195192 15:56576647-56576669 CAGAACAAAAAGGAATGGAATGG + Intergenic
1127202888 15:56676398-56676420 CAGAAAAAGAAAAAGTTGAGTGG - Intronic
1127324386 15:57881075-57881097 AAGAACATAAAGAAGTTGAAAGG - Intergenic
1127440559 15:59002782-59002804 AAGAACTAAAAGAAGGGAAGTGG - Intronic
1128749997 15:70141936-70141958 CAGCAGAAAATGAAGTGGACAGG + Intergenic
1128950038 15:71869651-71869673 TCAAACAAAAAGAAGGGGAGAGG + Intronic
1128984045 15:72206500-72206522 CAGAGCAGAAGGAAATGGAGGGG + Intronic
1128998024 15:72311105-72311127 AAGAATAAAAAGAAATGGGGAGG - Intronic
1129079618 15:73027303-73027325 CAGAACAAAAATAAATCTAGCGG - Intergenic
1129375568 15:75128399-75128421 CAAAACAAAAAGAGACGGAGGGG + Intergenic
1130529330 15:84734362-84734384 CAGAAAAAAAAAAAGCGGGGGGG - Intergenic
1130675836 15:85951219-85951241 CTGAAAAAAAAGGGGTGGAGGGG - Intergenic
1130943043 15:88527122-88527144 AAGAACAAAGAGAATAGGAGAGG - Intronic
1131681796 15:94731289-94731311 CACAACACAAACAAGTGAAGGGG - Intergenic
1131707761 15:95016651-95016673 CTGATCAGAAAGAAGAGGAGGGG + Intergenic
1202953376 15_KI270727v1_random:58616-58638 CAGATCAAAAAAAAGTGATGTGG - Intergenic
1132999895 16:2844021-2844043 AAGAAAAAAAAGAGATGGAGGGG + Intergenic
1133088090 16:3380758-3380780 CAGAAGAAAAAGAATTTAAGGGG - Intronic
1133139908 16:3736075-3736097 TAGAACAAGAAGAAGAGGAGAGG - Exonic
1133798407 16:9065197-9065219 AAAAACAAAAACAAGTGTAGTGG + Intergenic
1134210869 16:12275681-12275703 AAAAAAAAAAAGAATTGGAGAGG - Intronic
1134781399 16:16900097-16900119 CAGAGCAAAAATAAATGAAGTGG - Intergenic
1134854821 16:17509671-17509693 AAGAACAAAGAGAAGTTTAGAGG - Intergenic
1135016522 16:18928310-18928332 GAGAAGAAAAAGAAAAGGAGGGG + Intergenic
1135838723 16:25854109-25854131 CAAAAAAAAAAGACATGGAGTGG - Intronic
1135855272 16:26004022-26004044 ATGAACAAACAGAAGTAGAGAGG - Intronic
1136101234 16:27997848-27997870 AAAAAAAAAAAAAAGTGGAGAGG - Intronic
1137009478 16:35308929-35308951 AAGAAGAAAAAGAGGAGGAGTGG - Intergenic
1137028161 16:35498885-35498907 AAGAAAAAAAAGAGGAGGAGTGG - Intergenic
1137517104 16:49155965-49155987 CAGAACACAAAGATGTGTAAGGG - Intergenic
1137924789 16:52530333-52530355 CAAAAAAAAAAAAAGTGGGGTGG - Intronic
1139135210 16:64195048-64195070 TTGAAAAAAAAGAAGTGGGGTGG + Intergenic
1139211249 16:65079287-65079309 AAGCACAAAAAGGAGTTGAGGGG + Intronic
1139727741 16:68915179-68915201 AAAAAAAAAAAAAAGTGGAGAGG + Intronic
1140264158 16:73406076-73406098 CAGAACAAAAACATCTGGACTGG + Intergenic
1140277684 16:73525496-73525518 AAGAACAAACAGAAGAGAAGGGG + Intergenic
1141960023 16:87399571-87399593 CACAACAAAGAGAAGTTGAGTGG - Intronic
1142722244 17:1784272-1784294 CAGAACAAATAAAAGGGAAGGGG + Intronic
1143332473 17:6147921-6147943 CAGAATAAAAAGAAATGGGGAGG - Intergenic
1143420464 17:6787531-6787553 GACAAAAAAAAAAAGTGGAGGGG - Exonic
1143635159 17:8160213-8160235 TGGAACAAAAAGAAATGGAAAGG + Exonic
1144554902 17:16273593-16273615 CAGAAAAAAAAGCAGTGGCAGGG + Intronic
1145020327 17:19425457-19425479 GAGAACAAAAAGCAGATGAGTGG + Intergenic
1145331632 17:21877300-21877322 CAGAACAAAATGGAATGGAATGG + Intergenic
1146277499 17:31524770-31524792 CAGCACAAAAAGAAGAGGTGAGG + Intronic
1146286755 17:31579218-31579240 CAAAACAAAAAGAGATGGAAAGG + Intergenic
1146690488 17:34871669-34871691 CACTACAAAGAGAAGTTGAGGGG + Intergenic
1146736654 17:35243921-35243943 CCTAACAAAAAGAAGTAGTGGGG + Intronic
1146974645 17:37100105-37100127 CAGAAGAACAATAAGTGTAGCGG + Intronic
1147365795 17:39958325-39958347 CTGAACAAAAGGAGGTGGAATGG - Intergenic
1147498831 17:40942627-40942649 AAGAAGAAGAAGAAGAGGAGGGG - Intergenic
1148971717 17:51489496-51489518 CAGACCAAAAAAATGTGAAGTGG + Intergenic
1149046326 17:52249943-52249965 CAGAACAAAAAGAACACAAGGGG - Intergenic
1149351089 17:55788226-55788248 CACTACAAAAGGATGTGGAGAGG - Intronic
1150091832 17:62333049-62333071 AAAAAAAAAAAGAAGAGGAGAGG + Intergenic
1150386894 17:64768767-64768789 AAAAAAAAAAAAAAGTGGAGGGG + Intergenic
1150511265 17:65755286-65755308 CAGGAGAAAGAGAGGTGGAGAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150753099 17:67884414-67884436 CAGAAAAAAAAAAAAGGGAGGGG - Intronic
1150964159 17:69948422-69948444 AAGAAGAAGAAGAAGAGGAGGGG + Intergenic
1152064378 17:78102394-78102416 CAGCACAATAAGAAGTGGGGAGG + Intronic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203176013 17_KI270729v1_random:13578-13600 CAGAACAGAAAGTAATGGAATGG - Intergenic
1152963173 18:92649-92671 AAAAAAAAAAAGATGTGGAGTGG + Intergenic
1153178417 18:2405477-2405499 GAGAACTAAAAGAGGTGCAGTGG + Intergenic
1153635685 18:7110892-7110914 GAGAACAATTAGAAGTGGGGGGG - Intronic
1154478461 18:14791601-14791623 CAGAAAAAAGAGAAGTGAAACGG + Intronic
1155073404 18:22335712-22335734 CAGGACAAAAAAAAATGGATTGG - Intergenic
1155205053 18:23551436-23551458 CAGATTTAAAAGAAGTGGATTGG - Intronic
1155727812 18:29111461-29111483 AAAAAGAAAAATAAGTGGAGAGG - Intergenic
1155762774 18:29588343-29588365 CAGAGCAAGAAAAAGTAGAGTGG + Intergenic
1155834901 18:30568828-30568850 CAGCAAAAAAAGAATGGGAGTGG + Intergenic
1155856021 18:30835607-30835629 CAAAACAAAAAGAAGTAGGGTGG + Intergenic
1155946780 18:31861923-31861945 CAGAAAAAAAAAAAGGGGGGGGG + Intronic
1156008873 18:32473193-32473215 AAAAACAAAAAGCAGTTGAGAGG + Intergenic
1156026051 18:32656039-32656061 GAGAACACAAAAAAGTGGGGAGG - Intergenic
1156440556 18:37183086-37183108 TAGAAGAAAAACAAATGGAGGGG - Intronic
1156959765 18:43011412-43011434 GACAAGACAAAGAAGTGGAGGGG + Intronic
1157144884 18:45151976-45151998 CAGACCAAAATTAAGTGGTGTGG - Intergenic
1157153752 18:45244625-45244647 CAAAAGAAAAAGGAGTGGGGGGG + Intronic
1157209610 18:45730625-45730647 CATAAGAAAAAAAAATGGAGAGG - Intronic
1157266176 18:46224613-46224635 CTGAACAATAAGAACTGGAGTGG - Intronic
1157571954 18:48718591-48718613 CAGAACAAAAGGCAGAGGAGGGG - Intronic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1157880860 18:51319903-51319925 CAGCTCAAAGAGAAATGGAGAGG + Intergenic
1157990090 18:52484698-52484720 AAGAGCAAAAAGAAATTGAGTGG + Intronic
1158096082 18:53772858-53772880 CTGAGCATAAAGTAGTGGAGTGG + Intergenic
1158129253 18:54134559-54134581 GAGAAAAGAAAGAAGAGGAGAGG + Intergenic
1158197491 18:54905268-54905290 GAGAATGAAAGGAAGTGGAGGGG + Intronic
1158416544 18:57253919-57253941 CAGAACCTGTAGAAGTGGAGTGG + Intergenic
1158904226 18:61996280-61996302 CTAAACAAAAAGCAGCGGAGAGG + Intergenic
1159441347 18:68484675-68484697 CAGAAATAAAACAAGTGCAGTGG + Intergenic
1160234041 18:77071513-77071535 CAGAACAGAAAGATGAGGAAGGG + Intronic
1160303248 18:77705530-77705552 TAGAACAAAAAGCAGAGGAAGGG + Intergenic
1160548195 18:79675970-79675992 CAGAACAAAAGGAGGTTAAGGGG - Intergenic
1161492890 19:4571928-4571950 AAAAAAAAAAAAAAGTGGAGGGG - Intergenic
1162090244 19:8274914-8274936 CAGAAGAAAATGAATTTGAGAGG - Intronic
1162092476 19:8289775-8289797 CAGAAGAAAATGAATTTGAGAGG - Intronic
1162723423 19:12675756-12675778 CTGACCAAAAAGTAGGGGAGGGG + Exonic
1162747141 19:12805151-12805173 AAAAAAAAAAAAAAGTGGAGGGG + Intronic
1162793456 19:13074696-13074718 AAAAAAAAAAAAAAGTGGAGTGG - Intronic
1162984109 19:14258338-14258360 AAGAACAAAGGGAAGGGGAGGGG - Intergenic
1163024670 19:14503617-14503639 AAGAAAGAAAAGAAGAGGAGAGG - Intergenic
1163243956 19:16080986-16081008 CAGGACAAAAAGATATGGAAAGG - Intronic
1163369020 19:16891756-16891778 CAAAAAAAAGAGAAGAGGAGAGG + Exonic
1163596298 19:18222998-18223020 CAGAAAAAAAAGAAATGGGGAGG - Intronic
1163827874 19:19533639-19533661 AAGAAGAAAAAGAGGAGGAGGGG - Intronic
1163910158 19:20182421-20182443 CAGAACAAACAGAAGCTGTGGGG - Intronic
1163925333 19:20336203-20336225 CAAAACAAAAAGAAGGGAAGTGG + Intergenic
1164070046 19:21759297-21759319 TAGAACAAAAAGAAGAGGTGGGG + Intronic
1164250017 19:23468092-23468114 AAGAAGAAAAGGAGGTGGAGGGG - Intergenic
1164302431 19:23973561-23973583 AAGAGTAAAAAGAAGAGGAGAGG + Intergenic
1165588857 19:36947666-36947688 CATCTCAAAAAAAAGTGGAGTGG - Intronic
1166260786 19:41639471-41639493 CTGACCAAAAATAGGTGGAGAGG - Intronic
1166283086 19:41808180-41808202 CAGAACAACAAGGGGAGGAGGGG - Intronic
1166844851 19:45721007-45721029 AAAAAAAAAAAGAAGTGAAGCGG + Intronic
1167015635 19:46839322-46839344 AAGAAAAAAAAGAAATGGAGAGG + Intronic
1167674236 19:50874669-50874691 CAGACCCAAAAGAATTGGATAGG - Intronic
1168143820 19:54407941-54407963 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
925558807 2:5164996-5165018 CAGAAGAAGATGAATTGGAGTGG - Intergenic
926704932 2:15830361-15830383 TGGAACAAAAAGAAGAGAAGAGG + Intergenic
929042758 2:37761374-37761396 GAGAAATAAAAGAAGAGGAGAGG - Intergenic
931099249 2:58976916-58976938 TAGAACAAAAAGCACTGGAAGGG - Intergenic
931501845 2:62877176-62877198 CAGAAAACAAAAAAGAGGAGGGG + Intronic
931653556 2:64489887-64489909 CATAATAATAATAAGTGGAGAGG - Intergenic
931684421 2:64781390-64781412 CATAACAAAAGGAGGTGCAGGGG - Intergenic
931840358 2:66142006-66142028 CAGAATTAAAAGAACTAGAGAGG - Intergenic
931925546 2:67068077-67068099 CAGAAAAATAAAAAGAGGAGAGG - Intergenic
932320046 2:70815343-70815365 CAGAACAAAAAGAAGGGAAAAGG - Intronic
933289264 2:80419860-80419882 CTGAAACAAAAGAAGTGGAAGGG + Intronic
933453139 2:82483008-82483030 GAGAAGAGAAAGAAGAGGAGAGG - Intergenic
934652343 2:96099808-96099830 CAGAAGGAAGAGAAGGGGAGGGG + Intergenic
935195283 2:100810274-100810296 CAAAAGAAGAAGAAGGGGAGCGG + Intergenic
936102916 2:109599152-109599174 CAGAAAAAAAAGAACTCAAGTGG + Intronic
936175454 2:110216163-110216185 CAGAACAAAGAGAAGCTTAGAGG - Intergenic
936225536 2:110646340-110646362 CAGAAAGAAAAGAAGGGGAGGGG + Intronic
936651432 2:114431020-114431042 CAGAAGAAAAAGCCTTGGAGTGG + Intergenic
937459248 2:122071343-122071365 AAAAAAAAAAAAAAGTGGAGAGG - Intergenic
938612496 2:132962572-132962594 AAAAACAAAAAGACCTGGAGGGG - Intronic
939113983 2:138039792-138039814 CAGAAGAAAGAGGAATGGAGGGG + Intergenic
939130301 2:138227689-138227711 GAGAAGAAAAAGTAGAGGAGAGG - Intergenic
939268721 2:139910576-139910598 CAAAACAAAATCAAGAGGAGAGG - Intergenic
939654006 2:144800154-144800176 AAGAAAAAATATAAGTGGAGAGG - Intergenic
939756536 2:146119273-146119295 CAGAAGAAAGAGAAGTTTAGTGG + Intergenic
940040043 2:149350760-149350782 CAGAATAAAAACAAGTGCACAGG - Intronic
940089209 2:149897111-149897133 CAGTAGAAAAAGAAGTTCAGGGG + Intergenic
940129830 2:150368785-150368807 AAGAACAAAAGGACATGGAGTGG + Intergenic
940644790 2:156379919-156379941 TTGAAGAAAAAGAAGTGGAGAGG - Intergenic
940736838 2:157463341-157463363 CAGAACTGAAAGAGCTGGAGTGG + Intronic
941469068 2:165862067-165862089 CAGAAAAAAAAGAAGTTTAGTGG - Intronic
941638797 2:167965092-167965114 CAGTACAAAACAAAGAGGAGAGG + Intronic
941878788 2:170461172-170461194 CTTAACAAAAAGAAGTGCTGAGG + Intronic
941880760 2:170477841-170477863 CACATAAAAAAGAAGTTGAGAGG + Intronic
941934096 2:170970004-170970026 TAGAACAAGAAGACGTGGAAGGG + Intergenic
942307253 2:174620872-174620894 AAGAAGAATAAGGAGTGGAGGGG + Intronic
942523244 2:176826554-176826576 CAGAAGAACAAAAAGAGGAGGGG + Intergenic
942559350 2:177203810-177203832 CAGAACAAAAAGGGGTTGAGAGG + Intergenic
942597269 2:177603107-177603129 CAGAAGGAAAAGAGATGGAGTGG + Intergenic
944019309 2:195082248-195082270 GAGAACAGAAAGAAGTGAACAGG - Intergenic
944922484 2:204429939-204429961 CATAACAAGAAAAAGTCGAGTGG + Intergenic
945326619 2:208489502-208489524 AAGAGCAAAAAGGAGTGGGGAGG + Intronic
945744063 2:213699131-213699153 CAGAAAAATAAAAAGAGGAGTGG - Intronic
945926868 2:215814730-215814752 AAGAATAAAAAGAAGTTTAGTGG - Intergenic
945966551 2:216193586-216193608 GAGAACAAAAGGAATTGGAATGG + Intronic
945969699 2:216223544-216223566 CAGAACAAAAGGCAGAGGAAGGG + Intergenic
946148571 2:217749013-217749035 CAGAACAAAAGGGAGGGGGGTGG - Intronic
946547845 2:220765143-220765165 CAGAAAAATATAAAGTGGAGAGG - Intergenic
946754797 2:222933140-222933162 CAAAACAAAGAAAGGTGGAGAGG - Intronic
947082187 2:226411062-226411084 TAGAACAAAAAGAGGAGGAAGGG - Intergenic
947856066 2:233325375-233325397 CAGAACAAAATGGAATGGATTGG + Intronic
948172365 2:235914989-235915011 AAGAAGAGAAAGAAATGGAGAGG + Intronic
948255695 2:236567003-236567025 CAAAAGAAAAAGAAGGGAAGGGG - Intergenic
948360965 2:237419975-237419997 CAAAGCAGAGAGAAGTGGAGAGG + Intergenic
1168856017 20:1009632-1009654 GAGAACAAGAAGAAGTCCAGAGG - Intergenic
1169004042 20:2192230-2192252 AAAAAAAAAAAAAAGTGGAGAGG - Intergenic
1169344773 20:4821523-4821545 CAGAATAAAAATGAGGGGAGTGG + Intronic
1169525987 20:6426253-6426275 AAGAAGAAAGAGAAGGGGAGAGG - Intergenic
1169770727 20:9197178-9197200 CAGAAGAAAGACAACTGGAGAGG - Intronic
1170390045 20:15862654-15862676 TAGAACAAAAACAAATGGAAAGG - Intronic
1170462785 20:16594012-16594034 AAGAAAAAAGAGAAGAGGAGAGG + Intergenic
1171017467 20:21554929-21554951 CAGAACCAGAGAAAGTGGAGAGG - Intergenic
1171273294 20:23833292-23833314 CAGCCCAAAAGGAAGTGGTGGGG + Intergenic
1171918972 20:31082776-31082798 CAGAACAAAAAGGAATGGAACGG + Intergenic
1171926131 20:31190140-31190162 TAGAATAAAAAGAAATGGAAAGG + Intergenic
1171927461 20:31200864-31200886 CAGAATAAAAAGGAATGGAACGG + Intergenic
1172133555 20:32672696-32672718 CAGAACAAAAAGGCCTGGTGTGG - Intergenic
1172572928 20:35984441-35984463 CAGATTAAGAAGAAGGGGAGTGG + Intronic
1173500877 20:43552230-43552252 CAGAATAAAAAGAAAAAGAGAGG + Intronic
1174373497 20:50110329-50110351 CAGAACCAAAGGAAGTGGGAAGG + Intronic
1174413726 20:50353265-50353287 CAGACAAGAAGGAAGTGGAGTGG + Intergenic
1174613717 20:51819959-51819981 CAGAGCAGGAAGAAGTGAAGAGG + Intergenic
1174669124 20:52289808-52289830 GAGAACAATAGGAAGTGGTGGGG + Intergenic
1175147324 20:56906800-56906822 CAGAACAGAAAAAAGAGAAGGGG - Intergenic
1175182490 20:57158491-57158513 CAGAACGAAAAAAAGAGCAGAGG + Intergenic
1175506600 20:59490216-59490238 CAGAACAAAAATTAGAGGTGGGG + Intergenic
1175669504 20:60889967-60889989 CAGAGCAAACAGAAGTGCAAAGG + Intergenic
1175736518 20:61391062-61391084 CAGGACAAAAAGAAGCAGACAGG - Intronic
1175869696 20:62202754-62202776 AAAAAAAAAAAAAAGTGGAGGGG + Exonic
1176296133 21:5074301-5074323 CAAAACAAAAAAAGGTGGTGGGG + Intergenic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176478745 21:7258718-7258740 CAGAACAGAGTGGAGTGGAGTGG + Intergenic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176757040 21:10733270-10733292 CAGAGCAGAGAGGAGTGGAGTGG - Intergenic
1176926275 21:14753375-14753397 CAGAGGAAAAAGATGTGAAGAGG - Intergenic
1177368457 21:20170226-20170248 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
1177847986 21:26313739-26313761 AAAAACAAAAAAAGGTGGAGAGG + Intergenic
1178328383 21:31663967-31663989 AAAAACAAAAACAAGTTGAGGGG - Intronic
1178417619 21:32416627-32416649 CAAAAGAAAAAGAAAAGGAGAGG - Intronic
1178532289 21:33385779-33385801 CAAGACAAAAAAAAATGGAGTGG + Intergenic
1178871625 21:36381991-36382013 AAGAACAAAAAGTAGAGGAAGGG - Intronic
1179026672 21:37684341-37684363 CATAAAAAAAAAAAATGGAGTGG - Intronic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1179415916 21:41198698-41198720 CAAAACAAAAAAAAGGGCAGTGG - Intronic
1179579655 21:42333226-42333248 CAGAAAAAAAAGGAGTGGGGTGG - Intergenic
1179860916 21:44187820-44187842 CAAAACAAAAAAAGGTGGTGGGG - Intergenic
1181389143 22:22566901-22566923 CAAAAAAGAAAGAAGAGGAGAGG - Intergenic
1181389218 22:22567500-22567522 CAGAACAAGAGGGAGAGGAGAGG + Intergenic
1182119393 22:27776890-27776912 GAGAAGAAAAAGGAGAGGAGGGG + Intronic
1182138515 22:27930919-27930941 CACAATAAAAAGAAGGGCAGGGG - Intergenic
1182190007 22:28449781-28449803 CAGAACAATAAGGAATGAAGAGG + Intronic
1183017579 22:35002094-35002116 CACAACAAAAAATAGTGTAGAGG - Intergenic
1183473217 22:38020752-38020774 CAAAACACAAAGAAGTCGGGTGG + Intronic
1184151127 22:42639323-42639345 CAAAAAAAAAAAAAGTGGGGGGG + Intronic
1185236765 22:49718376-49718398 GAGAAGAAAGGGAAGTGGAGGGG - Intergenic
1203294942 22_KI270736v1_random:32864-32886 AAGAAATAAAAGAAGAGGAGAGG - Intergenic
1203303165 22_KI270736v1_random:91309-91331 AAATACAGAAAGAAGTGGAGTGG + Intergenic
1203303824 22_KI270736v1_random:95511-95533 TGGAATAAAAAGAGGTGGAGTGG + Intergenic
1203307987 22_KI270736v1_random:122931-122953 TGGAATAAAATGAAGTGGAGTGG + Intergenic
1203308082 22_KI270736v1_random:123609-123631 CAGAGCGGAAAGGAGTGGAGAGG + Intergenic
950587301 3:13903850-13903872 GAGAATGAAAAGAAGTGGGGTGG + Intergenic
950825535 3:15815594-15815616 CAGAACAATAAGAAGTGTGTGGG - Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951470910 3:23055173-23055195 CAGTACAAAAAGAAAATGAGGGG + Intergenic
951641023 3:24835619-24835641 CAGAACCAAAAGCATGGGAGTGG + Intergenic
952090310 3:29877342-29877364 CAGAACAAAAATAAGGGGAGAGG + Intronic
952147107 3:30545315-30545337 CAGAACAAAGAAAAGTGTTGGGG + Intergenic
952714124 3:36461605-36461627 AAGAAGAGAAAGAAGTGCAGAGG + Intronic
953110523 3:39933243-39933265 TAAAACATAAACAAGTGGAGTGG - Intronic
953247872 3:41212335-41212357 GAGAAGAAAAATAAGTGGAGGGG - Intronic
953810108 3:46104863-46104885 CAGAACAAGAAGCAGTGGGTTGG - Intergenic
953942170 3:47109652-47109674 AACAACAAAAAAATGTGGAGGGG + Intronic
954335320 3:49913021-49913043 CAGCATAACATGAAGTGGAGAGG + Intronic
954385960 3:50244014-50244036 AAAAAAAAAAAGGAGTGGAGGGG - Intronic
954718766 3:52541992-52542014 AAGAAGAAAAAGAAATGGAGAGG - Intronic
955261839 3:57399019-57399041 CAGAACAAAAAATGGGGGAGGGG + Intronic
955328097 3:58025086-58025108 AAGAAAAAAAAGAAATGGAAGGG - Intronic
955455473 3:59116533-59116555 AAAAAAAAAAAGAAGTGGACTGG - Intergenic
955668008 3:61370539-61370561 TTGAAGAATAAGAAGTGGAGTGG + Intergenic
956010684 3:64828369-64828391 CATAACAAAAGGATGTGTAGTGG + Intergenic
956198811 3:66683977-66683999 AAGAAGAAAAAGAAGAGGTGAGG - Intergenic
956206370 3:66759052-66759074 AAAAAAAAAAAGAAGTGGATTGG + Intergenic
956343374 3:68250678-68250700 CAGAACAAAAATTACTTGAGCGG + Intronic
956599817 3:71008897-71008919 CAGAAAAAAGAGAGGTGGGGGGG - Intronic
956716447 3:72084513-72084535 CAGGACAGAAAGACGGGGAGAGG - Intergenic
957208755 3:77233316-77233338 CAAAAATAAAAAAAGTGGAGGGG - Intronic
957930025 3:86865347-86865369 CAGAAAAAAAAGAAAAGGATGGG + Intergenic
959430471 3:106248939-106248961 AAGAACAAAAAGAAAAGGAAAGG + Intergenic
959677340 3:109051220-109051242 CAGCAAAAAGAGAAATGGAGAGG - Intronic
959942766 3:112096662-112096684 CAGAACAGAAAGTTGGGGAGGGG + Intronic
959992411 3:112643963-112643985 AAGAATAAAAAGAAAAGGAGGGG + Intronic
959998789 3:112708554-112708576 CACAACAAAAAGAACTAGAGAGG - Intergenic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
960931115 3:122851824-122851846 CATAACAAAAAAAAGTGGGTGGG - Intronic
960954069 3:123019030-123019052 CAGTACAAATAGCAGTAGAGTGG - Intronic
961337060 3:126186883-126186905 CAGGGCAAAAAGAAGTGGTGAGG + Intronic
961345341 3:126260294-126260316 AGGAAGAAAAAGATGTGGAGAGG - Intergenic
961603502 3:128077368-128077390 CAGAACAAATGGAAGGGGAGTGG + Intronic
962387324 3:134942455-134942477 CAAAACAAAACAAAATGGAGAGG + Intronic
962455141 3:135558201-135558223 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
962692232 3:137910354-137910376 CACAACTAAAAGAACTAGAGAGG + Intergenic
963457750 3:145567078-145567100 CAGAACAAACAAAATTTGAGAGG - Intergenic
963741640 3:149087084-149087106 AATAACAAAAAGAGGTGGGGAGG - Intergenic
963755294 3:149228601-149228623 CAGAACAAAAAAAAAAGGGGGGG - Intergenic
963931633 3:151009743-151009765 CAGTACCAAAGGAAGTGGGGTGG - Intergenic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964375226 3:156042619-156042641 CAAAACAAACAGAAGAGGATGGG - Intronic
964471727 3:157064059-157064081 CAGATGAAAAAGAAGTGGGGAGG - Intergenic
964558165 3:157963962-157963984 CAGAAAAAAAAAAAGGGGGGCGG + Intergenic
965519103 3:169655212-169655234 CAGAACAAGAGGGAGTGGCGGGG - Intronic
966292631 3:178378157-178378179 CAGAACAAATCGAAATGGAAAGG + Intergenic
966671135 3:182527436-182527458 AACAACAAAAAAAAGTTGAGGGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967046443 3:185741626-185741648 CAGAACAAAAAGCCATGGAAAGG + Intronic
967453768 3:189656839-189656861 CAAAACAGAAAGAAGTGAAGGGG + Intronic
967900918 3:194451505-194451527 CAGCAGAACAAGAAGAGGAGAGG + Intronic
969014866 4:4097316-4097338 TAAAAGAAAAAGATGTGGAGAGG + Intergenic
969195996 4:5564296-5564318 CTGCACTAATAGAAGTGGAGTGG - Intronic
969798314 4:9542938-9542960 CAGAAGAAAAAGGTGTGGACAGG - Intergenic
970762273 4:19505070-19505092 CAGAAGAAAAATAGGTGGATTGG + Intergenic
971005017 4:22363812-22363834 CAAAACAAAAAAAGGTGGAGTGG + Intronic
972157386 4:36181243-36181265 CTGGACAAAAAGAAAGGGAGTGG + Intronic
972577423 4:40364698-40364720 CAAAAAAAAAAAAAGTGGGGAGG - Intergenic
973304421 4:48629345-48629367 AAGAACAAAAAGGATGGGAGAGG + Intronic
974026784 4:56739715-56739737 AAGAAAAGAAAGAAGTAGAGTGG - Intergenic
974486047 4:62507326-62507348 AACAACAAAAAAAAGTAGAGAGG + Intergenic
974936375 4:68413624-68413646 AAAAAAAAAAGGAAGTGGAGAGG + Intergenic
975176514 4:71295644-71295666 AAGAAAGAAAAGAAGAGGAGAGG - Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976238994 4:82933381-82933403 AAAAAAAAAAAGATGTGGAGGGG + Intronic
976908571 4:90271188-90271210 CTGAACAAAAAGAAGAAGACTGG + Intronic
976975606 4:91162996-91163018 CACAATAAAAAGAAGTAGAGAGG - Intronic
977365211 4:96059045-96059067 CAGAAAAAGAAAAAGTGCAGTGG + Intergenic
977914277 4:102573635-102573657 CAGAAGAAGATGAAGAGGAGTGG - Intronic
977915961 4:102593422-102593444 CAGATAAAGAAGAAGTGCAGAGG + Exonic
978719518 4:111890911-111890933 CAGAAAAAAAAGGGGGGGAGGGG + Intergenic
979526483 4:121722797-121722819 CAAAACAAAAAGAAGTGAAATGG + Intergenic
979674620 4:123398135-123398157 CAGAAAAACAAGTAGGGGAGTGG - Intronic
980063023 4:128152650-128152672 AATAAAAAAATGAAGTGGAGAGG - Intronic
981720551 4:147797404-147797426 CAAAACAAAACAAAGTGGGGAGG - Intronic
982231695 4:153213995-153214017 AAGAAAAAAAAAAAGTGGATGGG + Intronic
982814090 4:159863724-159863746 AAGAAAAAAAAGAAGATGAGTGG - Intergenic
982875392 4:160641821-160641843 AAGAACAAAAAGAAGGCAAGAGG + Intergenic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
983425478 4:167578749-167578771 CACAACAAATAGAACTTGAGGGG + Intergenic
983868892 4:172802016-172802038 AAGGATAAAAAGAAGTGGAAAGG - Intronic
984424447 4:179565141-179565163 CAGGAGAAAAGGAAGTAGAGAGG - Intergenic
984600559 4:181721615-181721637 AAAAAAAAAAAGAAGTGGAGTGG + Intergenic
984846215 4:184110168-184110190 AAGAACAGAAAGAAGGGGTGAGG - Intronic
985516858 5:350781-350803 AAAAAAAAAAAGAAGTGGAAAGG + Intronic
985702813 5:1383748-1383770 CAGAACACAGCAAAGTGGAGTGG - Intergenic
987719952 5:21620173-21620195 CAGGAAAAAAAAAAGTGGGGGGG + Intergenic
988681357 5:33487478-33487500 CAGAACACAAAGAAATTTAGTGG - Intergenic
989156933 5:38353122-38353144 CTGAATAATAAGAAATGGAGAGG - Intronic
989456603 5:41651121-41651143 CAGAACAGATAGGAGTGGAGTGG + Intergenic
989557193 5:42811360-42811382 CAGAAGAAAAAGTGGTGGAATGG - Intronic
990367074 5:55082038-55082060 CAGAAAAAAAAAAAGGGGGGGGG - Intergenic
990463273 5:56048799-56048821 GAAACAAAAAAGAAGTGGAGAGG + Intergenic
990727094 5:58768070-58768092 CAGAACAGCAAGAAGAGGAATGG + Intronic
990948947 5:61277472-61277494 CTGAACTAAAAGCAGAGGAGAGG + Intergenic
991309880 5:65226234-65226256 TAGAAGAGAAATAAGTGGAGTGG + Intronic
991310295 5:65232664-65232686 CAGAACAATAATAAGAAGAGAGG + Intronic
991521862 5:67508238-67508260 CAAAACAAAGAGATTTGGAGTGG + Intergenic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
992270470 5:75057575-75057597 CAGAACACTGAGAAGTTGAGGGG + Intergenic
992381143 5:76239087-76239109 CAGGACATACAGAAGTGGGGGGG - Intronic
992381159 5:76239206-76239228 AAGAACAAAGAAAACTGGAGAGG - Intronic
992421075 5:76605251-76605273 CAGAAAAAAAGTAATTGGAGTGG + Intronic
992799462 5:80282472-80282494 CAGAACAAAAAGAAATGCTGTGG + Intergenic
993531471 5:89030142-89030164 AAAAAAAAAAAGAAGTAGAGTGG - Intergenic
993880146 5:93351790-93351812 AAAAAAAAAAAGAAGGGGAGTGG + Intergenic
994386426 5:99138272-99138294 CAGAAAAAAAAGATGTGAAGAGG - Intergenic
994601272 5:101908551-101908573 CAGAAGCAGAAGAAGTGGAAGGG - Intergenic
994974318 5:106782173-106782195 CAAAACATTAAAAAGTGGAGGGG + Intergenic
995451836 5:112310717-112310739 CAGAACAAAAAGGACTAAAGCGG - Intronic
995638620 5:114225909-114225931 CAAAACAAAATGAATTGAAGAGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995823313 5:116263753-116263775 GAGAACAAAAAGTAGGGGCGCGG - Intronic
996054458 5:118968299-118968321 CAGAAAAAAATGAACTTGAGTGG + Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996666960 5:126071094-126071116 AAAAAAAAAAAGCAGTGGAGGGG + Intergenic
997453329 5:134000666-134000688 CTGAAGAAAAAGGAGTAGAGAGG - Intronic
997465810 5:134087386-134087408 CAGAAAAATAGGGAGTGGAGAGG + Intergenic
998011017 5:138695694-138695716 AACAACAAAAAGAATTTGAGAGG + Intronic
998503390 5:142652865-142652887 CAGGGCAGAAGGAAGTGGAGGGG - Intronic
999347575 5:150838011-150838033 AAGAACAAAAAGATGGGGTGGGG - Intergenic
999446212 5:151641725-151641747 AAGAATAAAAAGGATTGGAGGGG + Intergenic
999747145 5:154600968-154600990 AAGAAGAAAAAGAACTGGGGAGG - Intergenic
999925852 5:156376267-156376289 GAGAACACAAAGAATTGTAGGGG + Intronic
999928598 5:156406434-156406456 CAAAATAAAGAGAAGAGGAGAGG - Intronic
999954672 5:156687433-156687455 CAGAACAAAAAGAAAAGGGGAGG + Intronic
1000248562 5:159470733-159470755 CAAAACAAAAAGAGTTTGAGAGG - Intergenic
1000771040 5:165354684-165354706 CAAAACAAAAAGACGTACAGTGG - Intergenic
1000941757 5:167370361-167370383 AAAAAAAAAAAGACGTGGAGAGG + Intronic
1001217806 5:169872131-169872153 GAGATGAAGAAGAAGTGGAGGGG - Intronic
1001350576 5:170959476-170959498 CAGAAGAAAGAGAAGTGCAAAGG - Intronic
1001491106 5:172155998-172156020 AAAAAAAAAAAGAAGTTGAGGGG + Intronic
1001543268 5:172553906-172553928 CACAACTAAAAGGAGTAGAGAGG - Intergenic
1001677095 5:173528094-173528116 CAGGACGAAGAGAAGAGGAGAGG - Intergenic
1002353054 5:178598334-178598356 CAGGAGAAAGAGAAGTGAAGGGG - Intergenic
1002463309 5:179387716-179387738 CTGAACAAAAGGGAGTGGCGGGG - Intergenic
1003221610 6:4165430-4165452 CAGAACAAATAGAAGAGAACTGG - Intergenic
1003251142 6:4430069-4430091 CAGAAGAAAAGGGAGTGAAGGGG + Intergenic
1003674893 6:8193854-8193876 TAGAACAAATAGAAGTGGGGAGG - Intergenic
1004080190 6:12384636-12384658 CAGAAAAAAAAAAAGTGGGCAGG - Intergenic
1004217030 6:13712100-13712122 GACAACAAAAAGAAGTCAAGTGG - Intergenic
1004976028 6:20967516-20967538 AACAACAAAAAGAAGTGGGGTGG - Intronic
1005149494 6:22732638-22732660 CAGAACAAAACCAAAAGGAGAGG + Intergenic
1005302435 6:24483892-24483914 CAAAACAAAACAAAGTGGTGGGG - Intronic
1005684139 6:28235829-28235851 CATAACAAAAAAAAGAGAAGAGG - Intergenic
1005733436 6:28721339-28721361 CTGCAAAAAAAGAAATGGAGTGG + Intergenic
1006590803 6:35155359-35155381 TAGAACAAAAAGAAGCTGATAGG - Intergenic
1006745507 6:36339207-36339229 CACAATAAAAAGAAGGGGAGGGG + Intergenic
1007189403 6:40000491-40000513 TAGAACAAAACCAAGTGTAGGGG - Intergenic
1007280431 6:40708388-40708410 CAGAAGAAAAAGAGGTGGAGGGG + Intergenic
1007386850 6:41526220-41526242 CAGAACAAAAAGAAAAGAAAAGG + Intergenic
1007757129 6:44107127-44107149 CAGAAGAAAAAGCAGTGAGGTGG + Intergenic
1008339958 6:50352823-50352845 CAGAACAAGAAGGAGGCGAGAGG + Intergenic
1008440582 6:51527789-51527811 AAGAAGAAGAAGAAGTGAAGGGG - Intergenic
1008964253 6:57298459-57298481 GAGAACAAAGAGATGAGGAGTGG + Intergenic
1010343005 6:74779403-74779425 GACAACAAAAAGCAATGGAGAGG - Intergenic
1010416333 6:75616047-75616069 AAGAACAAAAAGAACCAGAGAGG - Intronic
1010419729 6:75659056-75659078 TAGAACAAAATAAAGTGAAGAGG + Intronic
1010549537 6:77204232-77204254 CAGAACAGGTATAAGTGGAGGGG - Intergenic
1011111252 6:83838844-83838866 AAGGACAAAGAGAAGAGGAGTGG + Intergenic
1011165908 6:84445594-84445616 CAAAACAGGAAGAAGTAGAGGGG - Intergenic
1011445419 6:87434099-87434121 CAAAAAAAAAAGGAGTGGAAGGG + Intronic
1011631791 6:89333866-89333888 CAGTCCATAGAGAAGTGGAGAGG + Intronic
1011663464 6:89613851-89613873 CAGAACAGAAAGCAGTGAGGAGG - Exonic
1011738630 6:90337209-90337231 TAGAACAAAAGGCAGAGGAGTGG + Intergenic
1011983367 6:93414724-93414746 CACAACAAACAGAGTTGGAGTGG - Exonic
1012187198 6:96233522-96233544 CAGAATTAAAAGAAGTGAAGAGG + Intergenic
1012353144 6:98278287-98278309 CAAAACAAAAAGAAGAGAAAAGG + Intergenic
1013023042 6:106238908-106238930 AAGCATAAAAAAAAGTGGAGGGG + Intronic
1013068955 6:106710835-106710857 AAGGACAAAAAGAATAGGAGAGG - Intergenic
1013211898 6:107994466-107994488 AAAAACAAAAAGTAGTGGTGGGG - Intergenic
1013611734 6:111802249-111802271 CAGAGCAAGAGGAAGAGGAGAGG - Intronic
1013627657 6:111953490-111953512 CAGAAAAAAAAAAAGTTGAAAGG - Intergenic
1013635057 6:112021267-112021289 CATTAAAAAAAGAAGAGGAGAGG - Intergenic
1014037919 6:116789592-116789614 CAGAAACACAAGAAGTGGAGAGG + Intergenic
1014108514 6:117593880-117593902 CAGAACAAGAGAAACTGGAGAGG - Intronic
1014161495 6:118174500-118174522 CAGAATAAAAAGGAGAGGAGAGG + Intronic
1014561685 6:122898894-122898916 CATAACAAAAAGGTGTGAAGAGG - Intergenic
1015016237 6:128416655-128416677 AAAAAAAAAAAGAACTGGAGAGG + Intronic
1015186373 6:130421041-130421063 CAGATGAAACAGAAGGGGAGGGG - Intronic
1015351998 6:132231050-132231072 CAGAACAGAGAGAAGTTGAGAGG - Intergenic
1015593239 6:134842577-134842599 CAATACACAGAGAAGTGGAGAGG - Intergenic
1015655500 6:135513827-135513849 TAGAACAAAAAAAAAAGGAGTGG + Intergenic
1015766964 6:136728962-136728984 CAGAACAGAAAAAAAGGGAGAGG + Intronic
1015821862 6:137269837-137269859 CTTAACAAAAAGAAGAGGCGGGG + Intergenic
1016167777 6:140968925-140968947 CAGAACAGAAGAAAGGGGAGAGG + Intergenic
1016612979 6:146013879-146013901 CAGAAACAAAAGAAAGGGAGAGG - Intergenic
1017021912 6:150146774-150146796 CAGACTAAAACCAAGTGGAGGGG + Intronic
1017282636 6:152640189-152640211 CAGAAGAAAAAGCAAGGGAGGGG + Intergenic
1017776189 6:157682668-157682690 CAGAACTCAAAGAAGTTTAGGGG - Intergenic
1018251067 6:161871009-161871031 CAGAAGACAGAGAAGGGGAGAGG + Intronic
1018672778 6:166193423-166193445 AAAAAAAAAAAGAAGTTGAGGGG + Intergenic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1018779718 6:167052211-167052233 TAGCACAAAAACAAGTGAAGAGG - Exonic
1019011848 6:168849311-168849333 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
1019653964 7:2178045-2178067 CAGAACTAAATGAACTGAAGAGG + Intronic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1020377590 7:7505463-7505485 CAGAACAAAAAGATGCAGATGGG - Intronic
1020450062 7:8311001-8311023 CAGACCAAAAACAAGTAGTGAGG - Intergenic
1020605316 7:10330164-10330186 AAGAACAAAGAGAAGGGAAGTGG - Intergenic
1020688354 7:11323824-11323846 CAGAACAAATAGAAATAAAGGGG + Intergenic
1021277766 7:18675865-18675887 CAGAAGAAAAGGCAGTGGAGAGG - Intronic
1021790135 7:24196350-24196372 CACAACAAAGAGAGGGGGAGAGG - Intergenic
1022025610 7:26445068-26445090 AAGAACACAAAGCAGGGGAGTGG + Intergenic
1022235146 7:28453947-28453969 AAAAAAAAAAAGAATTGGAGAGG - Intronic
1022479212 7:30732171-30732193 AAGAAAAAAAAGAAGTGCATGGG - Intronic
1022590795 7:31660507-31660529 CAGAAAAAAAAAAATGGGAGAGG - Intergenic
1022895362 7:34745255-34745277 TAGACCAAAGAGAAGTGAAGAGG - Intronic
1023085770 7:36568737-36568759 GAGAAGAAAGAGAAGGGGAGGGG - Intronic
1023127155 7:36965716-36965738 CAGTCCATAAAGAAGTGGAAAGG + Intronic
1023254702 7:38301619-38301641 AATAAAAATAAGAAGTGGAGGGG - Intergenic
1023406767 7:39842070-39842092 CAGGACAGACAGAAGTGAAGGGG - Intergenic
1023520718 7:41047574-41047596 AAGAAAAGAAAGAAGTGGGGAGG + Intergenic
1023607565 7:41943867-41943889 CAGAAGAGGAAGAGGTGGAGAGG - Intergenic
1023670041 7:42566478-42566500 CAGAACATCAAAAAATGGAGAGG - Intergenic
1024236047 7:47399805-47399827 CAGAACAAAAATAAGTAAATGGG + Intronic
1024242048 7:47443175-47443197 CAGGAGACAAAGAAGTGGAGTGG - Intronic
1024331170 7:48156654-48156676 CAGAAGAAAAGTCAGTGGAGTGG + Intergenic
1025202614 7:56971492-56971514 CAAAACAAAAAAAAGGGCAGAGG - Intergenic
1026979314 7:74517360-74517382 AAGAAGAAGAGGAAGTGGAGAGG - Intronic
1027433460 7:78138352-78138374 GAGAAGAAAGAGAAGAGGAGAGG + Intronic
1027457657 7:78413675-78413697 GAGAAGAAAAAGAAGATGAGAGG + Intronic
1027746659 7:82083035-82083057 GAGAAAAACAAGAAGAGGAGAGG - Intronic
1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG + Intergenic
1028636298 7:92993434-92993456 GAGAACAAGAAGAAAGGGAGGGG + Intergenic
1029044319 7:97612117-97612139 CAAAACAAAATGGAGGGGAGAGG - Intergenic
1030822083 7:114106352-114106374 CAGAAAAAAAAAAAAAGGAGGGG - Intronic
1031277916 7:119754715-119754737 CAAATAAAAAAGAAGTGGGGAGG + Intergenic
1031543186 7:123020967-123020989 AATAACAAAAAGCAGTGGCGAGG - Intergenic
1031656092 7:124357659-124357681 CAGAACAAGAAGAAGATGAAGGG - Intergenic
1032353811 7:131190638-131190660 GAGAACAAAATGAGTTGGAGGGG + Intronic
1032853995 7:135818927-135818949 CAGAGGAAAAAGAAGAGGAGAGG - Intergenic
1032891239 7:136197834-136197856 AAGAAGAAAAAGAAGAAGAGAGG + Intergenic
1033004583 7:137547894-137547916 CAGAAGATAAAGAGGTGCAGAGG + Intronic
1034525254 7:151655594-151655616 CAGAGCAAAAAGAAAATGAGAGG + Intronic
1034628497 7:152512536-152512558 AAAAAAAAAAAGAAGTGGAGGGG + Intergenic
1034628545 7:152512846-152512868 CAAAAAAAAAAAAAGTGGAGGGG + Intergenic
1034879948 7:154755898-154755920 CATAATAAAAAGACGTGGTGAGG - Intronic
1034880762 7:154760777-154760799 CAAAACAAAAAGAAGGGTAAAGG + Intronic
1035729263 8:1842926-1842948 TGGAAGAAAAAGGAGTGGAGAGG + Intronic
1035945586 8:3957685-3957707 CGGAAAAAAAAGAAGAGAAGAGG + Intronic
1035977907 8:4333883-4333905 CAAAACAAAAAGAAATAAAGGGG - Intronic
1036405428 8:8450634-8450656 CAGAAAAAAAAAAAGTGTCGTGG + Intergenic
1036534053 8:9628021-9628043 CAGAGCAAAAAGTAGACGAGAGG - Intronic
1037116900 8:15237628-15237650 CGCAACTAAACGAAGTGGAGAGG + Exonic
1037337961 8:17810040-17810062 CAGAACAATAACAAGTAGTGAGG + Intergenic
1038421514 8:27436937-27436959 CTGATCAAGAAGAAGGGGAGTGG + Intronic
1039009003 8:33072762-33072784 CTGATTAAAAAGAGGTGGAGGGG + Intergenic
1039232444 8:35463458-35463480 CATAGCACTAAGAAGTGGAGCGG - Intronic
1039257948 8:35739790-35739812 TATAACAAAATGAAGTGGAAAGG - Intronic
1039374783 8:37022557-37022579 ATAAAGAAAAAGAAGTGGAGAGG + Intergenic
1039846287 8:41328004-41328026 TAGAACCAAAAGAAGTGCTGTGG - Intergenic
1040509223 8:48078792-48078814 CAGAACAAAAAGTGGAGGATGGG - Intergenic
1041278422 8:56187353-56187375 CAGAACCTAAAGCAGTGCAGGGG + Intronic
1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG + Intronic
1041929902 8:63275518-63275540 AAAAACAAAAAGAAGAAGAGGGG - Intergenic
1042108377 8:65353158-65353180 CACAACTAAAAGAACTAGAGAGG - Intergenic
1042873800 8:73422197-73422219 GAAAAGAAAAAGAAGTTGAGAGG - Intronic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1045089939 8:98731391-98731413 CAGATCAAAAAAAAGGGGAAAGG + Intronic
1045203872 8:100016363-100016385 CAAAAGAAAAAAAAGTGGAAGGG - Intronic
1045235568 8:100350206-100350228 TAGAACAAAAAACAGTGGAAAGG + Intronic
1045313226 8:101021628-101021650 AAGAACAAAGAAAACTGGAGGGG + Intergenic
1045536377 8:103032466-103032488 AAGAAAAAAAGGAAGGGGAGGGG - Intronic
1045578655 8:103453885-103453907 TAAAGCATAAAGAAGTGGAGGGG - Intergenic
1045630468 8:104114479-104114501 GAGAACAAAAAGATGTTGAAAGG + Intronic
1045662567 8:104453167-104453189 GAGAGCAAAAAGAATTGGAGTGG - Intronic
1046604671 8:116357909-116357931 TGGAACAGAAAGAAGTGGGGAGG + Intergenic
1046997832 8:120543952-120543974 CAAAAAAAAAAAAAATGGAGGGG - Intronic
1047231341 8:123000640-123000662 CAAAAAAGAAAGAAGGGGAGAGG + Intergenic
1047902682 8:129441284-129441306 CAGAGCAGAAAGATGTGAAGGGG - Intergenic
1049005036 8:139849446-139849468 CAGAACCAGAAGGAGAGGAGAGG - Intronic
1049049559 8:140183875-140183897 AAGAAGAAGAAGAAGAGGAGAGG + Intronic
1050266566 9:3896671-3896693 AAAAAAAAAAAGAAGTAGAGAGG + Intronic
1050559182 9:6817200-6817222 CAAAAAAAAAAAAAGTGGGGGGG - Intronic
1050564564 9:6868693-6868715 CAGATCAAAAATACGTGGAGGGG - Intronic
1050707897 9:8424662-8424684 CAGAAAATAAAGAAGGGGACTGG + Intronic
1051141003 9:13978870-13978892 AAGAAAAAGAAGAAGGGGAGTGG - Intergenic
1051319265 9:15883025-15883047 CAAAAGAAAAGGAAGGGGAGGGG - Intronic
1051412506 9:16805061-16805083 CAAAAGAAAAAAAAGTGGTGTGG + Intronic
1053429636 9:38033615-38033637 CATAACAAAAATATGGGGAGGGG - Intronic
1055029280 9:71756893-71756915 CATAACAAAATAAAGTGGAGTGG - Intronic
1055181304 9:73390000-73390022 CAGAAAAACAAGAAGTAGAAGGG - Intergenic
1057218242 9:93241554-93241576 CTCAGTAAAAAGAAGTGGAGGGG + Intronic
1058115293 9:101078171-101078193 AAGAAGAAGAAGAAGAGGAGGGG + Intronic
1059171625 9:112130372-112130394 CAAAAATAAAAGAAGGGGAGGGG + Intronic
1059265242 9:113022490-113022512 AAAAAAAAAAAGAAGTGAAGGGG + Intergenic
1059861727 9:118471000-118471022 CAAAAAAAAAAAAAGTGGAGAGG + Intergenic
1060586713 9:124791023-124791045 AAGAAGAAAAAGGAGTGGGGAGG - Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1060949709 9:127593983-127594005 CAAAACAAAAATAAGGGCAGGGG - Intergenic
1061638965 9:131936472-131936494 CAGAACTGCAAGGAGTGGAGGGG - Intronic
1062617900 9:137406469-137406491 CAAGACAAACAGAGGTGGAGCGG - Intronic
1062734918 9:138131052-138131074 AAAAAAAAAAAGATGTGGAGTGG - Intergenic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1203391664 Un_KI270438v1:102608-102630 TAGAACATAAAGAAATGGAATGG + Intergenic
1203391999 Un_KI270438v1:105511-105533 CAGAACGGAAAGAAATGGAAAGG + Intergenic
1203392241 Un_KI270438v1:107493-107515 TAGAACATAAAGAAATGGAATGG + Intergenic
1203392565 Un_KI270438v1:110306-110328 CAGAACGGAAAGAAATGGAACGG + Intergenic
1203392708 Un_KI270438v1:111599-111621 CAGAACGGAAAGAAATGGAACGG + Intergenic
1203343133 Un_KI270442v1:12278-12300 TAGAATGAAAAGGAGTGGAGTGG + Intergenic
1203344691 Un_KI270442v1:25366-25388 CAGAACAAAGTGACATGGAGTGG + Intergenic
1203345937 Un_KI270442v1:34288-34310 AGGAACACAATGAAGTGGAGAGG + Intergenic
1203347092 Un_KI270442v1:42668-42690 CAGAGCAGAGAGGAGTGGAGTGG + Intergenic
1203414627 Un_KI270589v1:43838-43860 CGGAACAAAACGAAATGGAATGG - Intergenic
1185474263 X:404389-404411 AAGGACACAAAGAAGTGCAGGGG - Intergenic
1185499248 X:584737-584759 AAGAAGAAAAGGAAGAGGAGGGG + Intergenic
1185573821 X:1154565-1154587 CAGAAGAAAAGAAAGGGGAGAGG - Intergenic
1185684556 X:1917645-1917667 CAAAAGAAAAAGAAGGGGGGGGG + Intergenic
1185709828 X:2294918-2294940 GAGAAGAAAAGGAAATGGAGAGG + Intronic
1186687840 X:11944170-11944192 CAAAATAACAAGAATTGGAGTGG - Intergenic
1187617279 X:21010832-21010854 CTGAAGAAAAAGAAATGAAGAGG + Intergenic
1187645012 X:21337967-21337989 CAGAGCAAAAAGAACTGAACTGG + Intergenic
1187909348 X:24096482-24096504 CAAAAAAAGAAGAAGAGGAGAGG - Intergenic
1188446644 X:30259666-30259688 AAAAAAAAAAAAAAGTGGAGGGG - Intergenic
1188677908 X:32965499-32965521 AAAAAAAAAAAGAAGTGGGGTGG + Intronic
1188745080 X:33831320-33831342 CACAAATAAAAGAAGTGGAGAGG - Intergenic
1189209651 X:39274128-39274150 CACAATTAAAAGAAGTAGAGAGG - Intergenic
1189375465 X:40463075-40463097 CAGAATACAAAGAAGTGGAGGGG + Intergenic
1189447855 X:41097636-41097658 CAGAACAAAAATTAGAAGAGAGG + Intronic
1189459128 X:41223193-41223215 TACAACAAAAAGGAGTGAAGGGG - Intronic
1190090684 X:47434648-47434670 CAGAAAAGAAAGACATGGAGAGG + Intergenic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1190300597 X:49054824-49054846 CAGAACAGGAAGGAGTGTAGGGG - Intronic
1191700943 X:64042372-64042394 CATATCAAAAAGAAGTCCAGGGG + Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1194585217 X:95724522-95724544 CAGAACAAGAAGAAATTGAGAGG - Intergenic
1195079105 X:101354527-101354549 GAGAAAAAAAAGAAAAGGAGAGG + Intronic
1195995289 X:110725511-110725533 GCGTACAAAAAGAAGTGAAGTGG - Intronic
1196686719 X:118516422-118516444 AAGAAGAAAAAGGAGGGGAGGGG - Intronic
1196697849 X:118633213-118633235 TAGTACAAAAAGAAGAGCAGTGG - Intronic
1197940796 X:131787238-131787260 AAGAACAAATATCAGTGGAGAGG - Intergenic
1198047700 X:132918861-132918883 CTGAGCATAAAGAAGTGGTGTGG - Intronic
1198082418 X:133252351-133252373 AAGAAAAGAAAGAAGGGGAGGGG + Intergenic
1198319240 X:135503438-135503460 CAGAAAAAAAAGATGTAAAGAGG - Intergenic
1199404304 X:147438383-147438405 CCGAGGAAACAGAAGTGGAGAGG + Intergenic
1199893235 X:152109131-152109153 CAAAACAAAAGGAAGTGGCTAGG - Intergenic
1199918186 X:152367812-152367834 CAGAGCAAATGGAAGTGCAGAGG - Intronic
1201101941 Y:10684711-10684733 CAGAACAAAGTGGAGTGGAGTGG - Intergenic
1201101942 Y:10684716-10684738 CTGAACAGAACAAAGTGGAGTGG - Intergenic
1201103434 Y:10745847-10745869 CAGAACAAAGTGGAGTGGAGTGG - Intergenic
1201103435 Y:10745852-10745874 CTGAACAGAACAAAGTGGAGTGG - Intergenic
1201103826 Y:10748696-10748718 AAGAACGGAAAGAAATGGAGCGG - Intergenic
1201104250 Y:10751753-10751775 CAGAATGAAATGGAGTGGAGTGG - Intergenic
1201106032 Y:10764041-10764063 CAGAATAGAATGCAGTGGAGTGG - Intergenic
1201106991 Y:10770687-10770709 CAGAACGAAATGGAGTGGAGTGG - Intergenic
1201107371 Y:10773166-10773188 CAGAATAGAATGGAGTGGAGTGG - Intergenic
1201110635 Y:10796771-10796793 CAGAACAGAATGGAGTGGACTGG - Intergenic
1201110742 Y:10797566-10797588 CAGAACAGAATGGAATGGAGTGG - Intergenic
1201111822 Y:10804983-10805005 CAGAGCAGAATGTAGTGGAGTGG - Intergenic
1201113609 Y:10819070-10819092 TGGAACAAAGAGGAGTGGAGTGG - Intergenic
1201114637 Y:10826110-10826132 CAGAATTAAATGGAGTGGAGTGG - Intergenic
1201115175 Y:10829871-10829893 CAGAACGAAATGAAGTGGAGTGG - Intergenic
1201117420 Y:10845302-10845324 CAGATCAGAGTGAAGTGGAGAGG - Intergenic
1201117496 Y:10845845-10845867 CGGAACAGAAGGAAGTGGATTGG - Intergenic
1201117799 Y:10847866-10847888 CAGATCAAAATGGACTGGAGTGG - Intergenic
1201118035 Y:10849482-10849504 CAGAATGTAAAAAAGTGGAGTGG - Intergenic
1201118594 Y:10855771-10855793 CGGAACAGAAAAGAGTGGAGTGG - Intergenic
1201119293 Y:10860745-10860767 CGGAATGAAAAGAAGTGGAGTGG - Intergenic
1201127189 Y:10925985-10926007 CGGAATGGAAAGAAGTGGAGTGG - Intergenic
1201136023 Y:10990747-10990769 CGGAATGGAAAGAAGTGGAGTGG - Intergenic
1201139071 Y:11013446-11013468 TGGAATAGAAAGAAGTGGAGTGG - Intergenic
1201210291 Y:11674297-11674319 TAGAACAAAAAGGAATGGAATGG + Intergenic
1201394531 Y:13534655-13534677 CAAAAAAAAAAAAAATGGAGTGG - Intergenic
1201980630 Y:19905905-19905927 ATGAAAGAAAAGAAGTGGAGAGG - Intergenic
1202174918 Y:22089095-22089117 CAGAACTAAAAGAAATAGAGAGG + Intronic
1202216444 Y:22497287-22497309 CAGAACTAAAAGAAATAGAGAGG - Intronic
1202306180 Y:23473363-23473385 CACATCAATAAGAAGTGGATAGG + Intergenic
1202326743 Y:23698782-23698804 CAGAACTAAAAGAAATAGAGAGG + Intergenic
1202544026 Y:25971271-25971293 CAGAACTAAAAGAAATAGAGAGG - Intergenic
1202564629 Y:26197226-26197248 CACATCAATAAGAAGTGGATAGG - Intergenic