ID: 983058618

View in Genome Browser
Species Human (GRCh38)
Location 4:163129056-163129078
Sequence TGGTGGGGGTGGAGGGCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10528
Summary {0: 1, 1: 1, 2: 20, 3: 426, 4: 10080}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983058605_983058618 0 Left 983058605 4:163129033-163129055 CCCATGTTTACAGGTGGGGGTGG 0: 1
1: 0
2: 6
3: 73
4: 276
Right 983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG 0: 1
1: 1
2: 20
3: 426
4: 10080
983058597_983058618 20 Left 983058597 4:163129013-163129035 CCATGTTTGGTGTAGCCCAACCC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG 0: 1
1: 1
2: 20
3: 426
4: 10080
983058607_983058618 -1 Left 983058607 4:163129034-163129056 CCATGTTTACAGGTGGGGGTGGT 0: 1
1: 0
2: 17
3: 129
4: 305
Right 983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG 0: 1
1: 1
2: 20
3: 426
4: 10080
983058600_983058618 5 Left 983058600 4:163129028-163129050 CCCAACCCATGTTTACAGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 109
Right 983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG 0: 1
1: 1
2: 20
3: 426
4: 10080
983058602_983058618 4 Left 983058602 4:163129029-163129051 CCAACCCATGTTTACAGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG 0: 1
1: 1
2: 20
3: 426
4: 10080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983058618 Original CRISPR TGGTGGGGGTGGAGGGCGGA GGG Exonic
Too many off-targets to display for this crispr