ID: 983063048

View in Genome Browser
Species Human (GRCh38)
Location 4:163179493-163179515
Sequence TTTATCTTCTCAGCAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983063045_983063048 -1 Left 983063045 4:163179471-163179493 CCCTTGGGTCCATCTCTCTACAT No data
Right 983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG No data
983063041_983063048 27 Left 983063041 4:163179443-163179465 CCTGTTGTAACTGGACTTCTGGG No data
Right 983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG No data
983063046_983063048 -2 Left 983063046 4:163179472-163179494 CCTTGGGTCCATCTCTCTACATT No data
Right 983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG No data
983063047_983063048 -10 Left 983063047 4:163179480-163179502 CCATCTCTCTACATTTATCTTCT No data
Right 983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983063048 Original CRISPR TTTATCTTCTCAGCAAACCC AGG Intergenic
No off target data available for this crispr