ID: 983063467

View in Genome Browser
Species Human (GRCh38)
Location 4:163183993-163184015
Sequence GTGTGTCTGAGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983063467_983063473 12 Left 983063467 4:163183993-163184015 CCTGCTTCCCTCCTCAGACACAC No data
Right 983063473 4:163184028-163184050 ACATTATGGTGGAGAGAGTAAGG No data
983063467_983063471 -2 Left 983063467 4:163183993-163184015 CCTGCTTCCCTCCTCAGACACAC No data
Right 983063471 4:163184014-163184036 ACTCAAGATCAGTCACATTATGG No data
983063467_983063472 1 Left 983063467 4:163183993-163184015 CCTGCTTCCCTCCTCAGACACAC No data
Right 983063472 4:163184017-163184039 CAAGATCAGTCACATTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983063467 Original CRISPR GTGTGTCTGAGGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr