ID: 983074784

View in Genome Browser
Species Human (GRCh38)
Location 4:163312739-163312761
Sequence CTGTGTGTATGGGGGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983074784_983074796 28 Left 983074784 4:163312739-163312761 CCTTGCCACCCCCATACACACAG No data
Right 983074796 4:163312790-163312812 AGTGGAACATTTGTTACAATTGG No data
983074784_983074792 10 Left 983074784 4:163312739-163312761 CCTTGCCACCCCCATACACACAG No data
Right 983074792 4:163312772-163312794 ATGAAAATCCCACACCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983074784 Original CRISPR CTGTGTGTATGGGGGTGGCA AGG (reversed) Intergenic
No off target data available for this crispr