ID: 983081580

View in Genome Browser
Species Human (GRCh38)
Location 4:163391806-163391828
Sequence CTGTACACACAAATGTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983081578_983081580 3 Left 983081578 4:163391780-163391802 CCCAGAGAAGATTAACAATACAA No data
Right 983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG No data
983081579_983081580 2 Left 983081579 4:163391781-163391803 CCAGAGAAGATTAACAATACAAA No data
Right 983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983081580 Original CRISPR CTGTACACACAAATGTAGAT AGG Intergenic
No off target data available for this crispr