ID: 983084652

View in Genome Browser
Species Human (GRCh38)
Location 4:163428038-163428060
Sequence CTAGCTACTTCCTGCTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 814
Summary {0: 131, 1: 96, 2: 63, 3: 198, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983084652_983084657 30 Left 983084652 4:163428038-163428060 CCTATCCAGCAGGAAGTAGCTAG 0: 131
1: 96
2: 63
3: 198
4: 326
Right 983084657 4:163428091-163428113 TAGGGTGTCCTATTTAGAGAGGG No data
983084652_983084655 12 Left 983084652 4:163428038-163428060 CCTATCCAGCAGGAAGTAGCTAG 0: 131
1: 96
2: 63
3: 198
4: 326
Right 983084655 4:163428073-163428095 TCAATTCGCAACTGCAGTTAGGG No data
983084652_983084656 29 Left 983084652 4:163428038-163428060 CCTATCCAGCAGGAAGTAGCTAG 0: 131
1: 96
2: 63
3: 198
4: 326
Right 983084656 4:163428090-163428112 TTAGGGTGTCCTATTTAGAGAGG No data
983084652_983084654 11 Left 983084652 4:163428038-163428060 CCTATCCAGCAGGAAGTAGCTAG 0: 131
1: 96
2: 63
3: 198
4: 326
Right 983084654 4:163428072-163428094 CTCAATTCGCAACTGCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983084652 Original CRISPR CTAGCTACTTCCTGCTGGAT AGG (reversed) Intergenic
901384454 1:8898229-8898251 CTAGGTACTTCTTGCTGGATAGG - Intergenic
902032048 1:13430309-13430331 CTAGCTACTTCCTGCTGGATAGG - Intergenic
902897371 1:19488160-19488182 CTAGGTATTTCCTGATGTATTGG + Intergenic
904366070 1:30011690-30011712 CTGGCTCCTTCCTGCTGCCTGGG + Intergenic
904710844 1:32428843-32428865 CTGGCTACTTCCTTCTGAAAAGG - Intergenic
905342182 1:37286860-37286882 GTAGCCTCTTCCTGCTGGAAAGG - Intergenic
905567618 1:38978366-38978388 CTAGCTACTTCCTGCTGGATAGG + Intergenic
905950930 1:41949914-41949936 CTAACTGCTTCCTGCTGAACTGG - Intronic
906506786 1:46386162-46386184 CTAACTGCTTCCTGCTGAATTGG + Intergenic
906574745 1:46878098-46878120 CTTGCTACTGCCTGCTGAAAAGG + Intergenic
906583857 1:46958502-46958524 CTAACTGCTTCCTGCTGAACTGG - Intergenic
906597226 1:47089805-47089827 CTTGCTACTGCCTGCTGAAAAGG - Intronic
906767160 1:48444016-48444038 CTAGCTACTTCCTGCTGGATGGG - Intronic
906884135 1:49626265-49626287 CTAGCTTCTTCTGGCTGGAATGG + Intronic
907037620 1:51230089-51230111 CTAACTGCTTACTGCTGAATTGG - Intergenic
907103028 1:51854424-51854446 CTGCCTACTTCCTGTTGAATTGG - Intronic
907505023 1:54911824-54911846 CTAACTGCTTCCTGCTGAATTGG + Intergenic
907602342 1:55784004-55784026 CTAACTGCTTCCTGCTGAATTGG + Intergenic
907647000 1:56254293-56254315 GTATCTACTTCCTGCTGATTAGG + Intergenic
907793704 1:57693206-57693228 CTAGCTACTTCCTGCTAAGTAGG - Intronic
907843002 1:58174524-58174546 CTAGCTACTTCCTGCTGGATGGG - Intronic
907888221 1:58613722-58613744 CTAGCTTCTTCCTGTTGGCAAGG - Intergenic
908658910 1:66417595-66417617 CTAGCTACTTCCTGATGGATAGG + Intergenic
909358993 1:74740974-74740996 CTAGCTACTTCCTGCTGGATAGG + Intronic
910192797 1:84611594-84611616 CTGGCTACTTCCCGCTGGAGAGG - Intergenic
910396862 1:86802375-86802397 CTAGCTACTTCCTGCTGGATAGG + Intergenic
910591491 1:88931492-88931514 CTAACTGCTTCCTGCTGAACTGG - Intergenic
910629951 1:89344216-89344238 CTAGCTACTTCCTGCTAATAAGG - Intergenic
910804939 1:91180736-91180758 CTAACTGCTTCCTGCTGAATTGG - Intergenic
911129223 1:94372375-94372397 CTAGCTACTTCCTGCTGGATAGG + Intergenic
911299296 1:96152917-96152939 CTAGCTACTTCCTGCTGGATAGG - Intergenic
911769653 1:101724265-101724287 ATAGCTAACTCCTGCTGGGTAGG - Intergenic
911822611 1:102440006-102440028 CTGGCTACTTCCTACTGAAAAGG - Intergenic
911845230 1:102744668-102744690 CTAGCTACTTCCTGCTGAATAGG + Intergenic
911907640 1:103589817-103589839 CTCGCTACTTCCTGCTGGAAAGG + Intergenic
912021813 1:105115307-105115329 CTAGCTACTTCCTGCTGGATGGG - Intergenic
912609940 1:111032764-111032786 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
912981617 1:114379135-114379157 CTGGCTACTTCCTGCTAAAATGG - Intergenic
913383308 1:118232794-118232816 CTAGTTACTTCCTGCTGGATAGG - Intergenic
913468561 1:119168682-119168704 GTAACTGCTTCCTGCTGAATTGG + Intergenic
913470106 1:119178805-119178827 CTAGCTACTTCCTGCTGGATAGG - Intergenic
913713829 1:121513563-121513585 TTAGCTACTTCCTGCTGGATAGG - Intergenic
915074170 1:153295308-153295330 CTGGCTACTTCCTGCATGAGGGG + Intergenic
915401102 1:155622447-155622469 CTAGCTACTTCCTGCTGAGCTGG + Intergenic
915646110 1:157273834-157273856 CTGGCTACTTCCTGCTGGGAAGG + Intergenic
915665717 1:157442447-157442469 CTAGCTACTTCCTGCTGAGAGGG + Intergenic
916084274 1:161257296-161257318 CTAGCTACTTCCTGCTGGATGGG - Intergenic
917086862 1:171312324-171312346 CTAGCTACTTCCTGCTGGATAGG - Intergenic
917227923 1:172803586-172803608 GTAGCTACTTCCTGCTGGATAGG - Intergenic
917280621 1:173375344-173375366 CTAGCTACTTCCTGCTGGATAGG - Intergenic
917281534 1:173381676-173381698 GTAGCTACTTCCTGCTGGATAGG - Intergenic
917445502 1:175102923-175102945 CTAGCTACTTCCTGCTGGATGGG + Intronic
917575540 1:176317452-176317474 CTGGCTACTTCTTGTTGAATTGG + Intergenic
917676706 1:177325374-177325396 CTAGCTACTTCCTCCTGGATAGG - Intergenic
917719404 1:177772530-177772552 CTTTCCACTTCCTGCTGGCTGGG - Intergenic
918011048 1:180586834-180586856 CTTTCTACTTCCTGCTGAAATGG - Intergenic
918154486 1:181832162-181832184 CTAGCTACTTCCTGCTGGATGGG - Intergenic
918749743 1:188258071-188258093 CTAGCTACTTCCTGCTGGATGGG + Intergenic
919328558 1:196139455-196139477 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
919919830 1:202161264-202161286 CTATCTGCTTCCTGCTGGGCTGG - Exonic
920756586 1:208739418-208739440 CTAGCTACTTCCTGCAGGATAGG - Intergenic
921020269 1:211228769-211228791 CTAGCTACTTCCTGCTGAACAGG - Intergenic
921092377 1:211856131-211856153 CTAACTGCTTCCTGCTGAATTGG + Intergenic
922550696 1:226492040-226492062 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
922684004 1:227625334-227625356 CTAACTGCTTCCTGCTGAATTGG + Intronic
924278294 1:242410133-242410155 CTGGCTACTTCTTGCTGAAAAGG + Intronic
924621942 1:245669635-245669657 ATAGCTACATCCTGCTGGCTAGG - Intronic
1063321130 10:5053721-5053743 CTAGCTAATTGCTGCTGGATAGG + Intronic
1063322647 10:5065900-5065922 GTAGCTGCTTCATGCTGGCTTGG + Intronic
1063415302 10:5868329-5868351 CTAGCTACTTCCTGCTGGATAGG - Intronic
1064197683 10:13259339-13259361 CTGGCTACTTCCTGCTGGATAGG - Intergenic
1064602972 10:17011988-17012010 CTAGCTACTTCCCGCTGGATAGG + Intronic
1064985831 10:21208890-21208912 CTAGCTACTCCTTGCTGGAAGGG - Intergenic
1065083023 10:22145826-22145848 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1065199054 10:23296585-23296607 CTAATTGCTTCCTGCTGAATTGG + Intronic
1066293532 10:34035142-34035164 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1066613681 10:37275938-37275960 CTAGCTACTTCCTGCTGCATAGG + Intronic
1067294197 10:44965432-44965454 CTAGCCACTTCTTTCAGGATGGG + Intronic
1067326648 10:45274869-45274891 CTGGCTACTTCCTGCTGATGAGG + Intergenic
1067713055 10:48665679-48665701 CTAACTGCTTCCTGCTGAACTGG + Intergenic
1068142511 10:53025945-53025967 CTGGCTACTTCCTGCTGGTTAGG + Intergenic
1068240994 10:54300540-54300562 CTAGCTACTTCCTGCCGGATAGG - Intronic
1068404598 10:56573399-56573421 GTAGCTACTTCCTGCTGGAAAGG + Intergenic
1068501219 10:57841481-57841503 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1069250390 10:66259301-66259323 CTGGTTACTTCCTGCTGAAAGGG - Intronic
1069364636 10:67684572-67684594 CTAGCTACTTCCTGCTGGATAGG + Intronic
1069940116 10:71949499-71949521 CTGGCTGCTTCTTGCTGGATAGG + Intergenic
1070855322 10:79603862-79603884 TTAGCTACTTCCTGCTGACAGGG + Intergenic
1071057844 10:81531502-81531524 CTAGCTGTTTCCTGCTGAATTGG - Intergenic
1071326788 10:84526188-84526210 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1071378893 10:85037902-85037924 TTGGCTACTTCCTGCTGGATGGG - Intergenic
1071476561 10:86030607-86030629 CTGGCTACTTACTGCTGAAAAGG - Intronic
1071835320 10:89412132-89412154 CTAGCTACTTTCTGCTGGATAGG - Intronic
1071902818 10:90139319-90139341 CTGGATACTTCCTGCTGAAAAGG - Intergenic
1072267082 10:93741209-93741231 CTGGCTACTTCCTCCTGAAAGGG - Intergenic
1072370752 10:94764581-94764603 GTAGCTACTTCCTGCTGGAGAGG + Intronic
1072377666 10:94834951-94834973 CTAGCTGCTTCCTGCTGAATTGG + Intronic
1072471449 10:95717746-95717768 TTAACTGCTTCCTGCTGAATTGG + Intronic
1072650418 10:97290859-97290881 CTAACTGCTTCCTGCTGAATTGG - Intronic
1072677540 10:97479428-97479450 CTGGCTACTTCCTACTGAAAAGG - Intronic
1073949270 10:108787227-108787249 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1073971321 10:109047753-109047775 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1074613378 10:115042057-115042079 GTAGCTACTTCCTGCTGGATAGG - Intergenic
1074742321 10:116497327-116497349 CTAGCTACTTCCTGCTGGATGGG + Intergenic
1075146911 10:119890222-119890244 GTAGCTACTTCCTGCTGGATGGG - Intronic
1075188693 10:120286329-120286351 CTAGCTACTTGCTGCAGGTGTGG + Intergenic
1077323107 11:1951165-1951187 CTAGCCTCTTCCTGCTGGGAAGG + Intronic
1077837555 11:5937864-5937886 CTGGCTACTTCCTGCTGTTAAGG - Intronic
1079074900 11:17378605-17378627 CTGGCTGCTTCCTGCTGGAAGGG - Intergenic
1079811061 11:25000344-25000366 CTAGCTACTTCCTGCTGGATAGG + Intronic
1079933330 11:26591266-26591288 TTAACTGCTTCCTGCTGAATTGG + Intronic
1080726903 11:34907057-34907079 CTGGCTACTTCCTGCCGAAAAGG - Intronic
1080917314 11:36673305-36673327 CTGGCTACTTCCTGCTAAAAAGG - Intergenic
1081033785 11:38116584-38116606 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1081146420 11:39566127-39566149 CTAGCTACTTCCTGCTGTATGGG - Intergenic
1081179423 11:39968090-39968112 TTAGCTACTTCCTGCTAAAAGGG - Intergenic
1081421979 11:42881121-42881143 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1082228377 11:49735363-49735385 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1083104265 11:60342997-60343019 CTGACTACTTCCTGCTGAAAAGG + Intronic
1083907532 11:65683042-65683064 CTGGCTACTTCCTGGTGAAAGGG + Intergenic
1084211551 11:67626215-67626237 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1084879980 11:72163956-72163978 CTAGGTACTCCCTGCTTCATGGG - Intergenic
1085222163 11:74883725-74883747 CTGGCTACTTCCTGCTGAAGAGG - Intronic
1085269486 11:75261921-75261943 CTAACCCCTTCCTCCTGGATGGG + Intergenic
1085523142 11:77149864-77149886 CTAGCTCCTCCCTGCTGGCTGGG - Intronic
1085569866 11:77550102-77550124 CTGGTTACTTCCTGCTGAAAGGG - Intronic
1085601322 11:77858682-77858704 CTAACTGCTTTCTGCTGAATTGG + Intronic
1086054271 11:82628651-82628673 CTAACTACTTCCTGCTGGATAGG - Intergenic
1086112671 11:83216917-83216939 CTGGCTACTTCCTGCTGGTTAGG + Intronic
1086318007 11:85613386-85613408 CTAGCTACTTTCTGCTGGATGGG - Intronic
1086441523 11:86833868-86833890 CTAACTGCTTCTTGCTGAATTGG + Intronic
1086443426 11:86850340-86850362 CTAGCTACTTCCTGCTGGTTAGG - Intronic
1086621690 11:88893789-88893811 CTGGCTACTTCCTGCTGAAAAGG - Intronic
1087075656 11:94125207-94125229 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1087308029 11:96506897-96506919 GTGGCTGCTTCCTGCTGAATAGG - Intronic
1087396696 11:97609585-97609607 TTAGCTACTTCCTGCTGACAGGG + Intergenic
1087423636 11:97964192-97964214 CTAGCTACTTCCTGCTGGAGAGG + Intergenic
1087458664 11:98420054-98420076 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1087682432 11:101231949-101231971 CTAGCTACTTCCTGCTGCATAGG + Intergenic
1088493202 11:110406402-110406424 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1089381667 11:118037162-118037184 CTAACTGCTTCCTGCTGAACTGG + Intergenic
1090232796 11:125120937-125120959 CTAGATTCTGCCTGATGGATGGG - Intergenic
1090754736 11:129779886-129779908 CTAGCTACTTCCCACTGGAGAGG + Intergenic
1202806092 11_KI270721v1_random:6360-6382 CTAGCCTCTTCCTGCTGGGAAGG + Intergenic
1091574047 12:1715618-1715640 CTAGCTACTTCCTGCTGGATAGG - Intronic
1091737050 12:2931338-2931360 CAATCTACTTCCAGCTGGCTTGG - Intronic
1092294330 12:7186125-7186147 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1092337445 12:7645858-7645880 CTGGCTACTTCCTGTTGAAAAGG - Intergenic
1092468991 12:8761802-8761824 TTAACTGCTTCCTGCTGAATTGG + Intronic
1092472864 12:8794463-8794485 CTAGCTACTTCCTGCTGGATGGG - Intergenic
1092565486 12:9660721-9660743 CTAACTACTTCTTGCTGATTAGG - Intergenic
1093023111 12:14221029-14221051 CTAGCTACTTCCTGCTGAACTGG - Intergenic
1093346181 12:18039992-18040014 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1093369760 12:18353160-18353182 TTAGCTACTTCCTGCTGACAGGG + Intronic
1093527185 12:20115851-20115873 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1093580239 12:20778034-20778056 TTAGCTACTTCTTGCTGTATAGG + Intergenic
1093594708 12:20946630-20946652 CTGGCTATTTCCTGCTGGAGAGG + Intergenic
1093687399 12:22072224-22072246 CTGGCTGCTTCCTGCTGAAAGGG + Intronic
1094289407 12:28830302-28830324 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1094319399 12:29169222-29169244 GTAGCTACTTCCTGCTGGATAGG + Intronic
1094477175 12:30850200-30850222 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1094527452 12:31241560-31241582 CTGGCTACTTCCTGCTGAATTGG - Intergenic
1094641102 12:32276270-32276292 CTAACAGCTTCCTGCTGAATTGG - Intronic
1094806902 12:34102554-34102576 CTAACTGCTTCCGGCTGAATTGG - Intergenic
1095082910 12:38028653-38028675 CTAAATGCTTCCTGCTGAATTGG + Intergenic
1095125745 12:38474018-38474040 CTAACTGCTTCCTGCTGCATTGG - Intergenic
1095139193 12:38641138-38641160 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1095284130 12:40388724-40388746 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1095573132 12:43705186-43705208 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1096351302 12:50903312-50903334 CTAACTGCTTCCTGCTGAACTGG + Intergenic
1096658633 12:53107217-53107239 CTGGCTACTTCCTGCTGAGAGGG + Intronic
1097315764 12:58169943-58169965 CAAACTACTTCCTGCTGTCTTGG + Intergenic
1097428593 12:59475286-59475308 CAAGCTACTTCCTACTGGATAGG - Intergenic
1097819094 12:64109617-64109639 TATGCTACTTCCTGCTGTATGGG + Intronic
1099414452 12:82370103-82370125 CTAGCTAATTCCTGCTGGATAGG + Intronic
1099605655 12:84798265-84798287 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1099797877 12:87421610-87421632 CTAGCTACTTCCTGCTGGAGAGG + Intergenic
1100050526 12:90443851-90443873 CTGGCTAATTCCTGCTGGATAGG + Intergenic
1100210479 12:92393672-92393694 CTAGCTACTTCCTGCTGGATGGG - Intergenic
1100219979 12:92494270-92494292 CTAGTTACTGGCTGCTGAATTGG - Intergenic
1100529293 12:95449232-95449254 CTAGCTACTTTCTGCTGGATAGG + Intergenic
1101383065 12:104231262-104231284 CTGGCTACTTCCTGCTGAAAAGG + Intronic
1101465367 12:104943638-104943660 CTAACTGCTTCCTGCTGAATTGG - Intronic
1101705532 12:107217208-107217230 CTAGCTACTTCCTGCTGGATGGG - Intergenic
1103803854 12:123557328-123557350 CTAACTGCTTCATGCTGAATTGG - Intergenic
1104306884 12:127617619-127617641 CTAGCTACTTTCTGCTGGATAGG - Intergenic
1104767957 12:131342589-131342611 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1105763059 13:23531300-23531322 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1105784446 13:23734736-23734758 CTGGCTACTTCCTGCTGGAAAGG - Intronic
1106163285 13:27219509-27219531 GTAGCTACTTCCTGCTGGATAGG - Intergenic
1106471506 13:30060167-30060189 CTGGCTACGTCCTGCTGAAAGGG - Intergenic
1106622986 13:31389240-31389262 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1106643525 13:31609449-31609471 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1107137346 13:36958580-36958602 CTAACCGCTTCCTGCTGAATTGG - Intronic
1107976768 13:45696007-45696029 CTAACTTCTTCCTGCTGACTAGG + Intergenic
1108149781 13:47521420-47521442 CTAGCTACTTACTGCTGGATAGG + Intergenic
1108515701 13:51200634-51200656 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1108818414 13:54317633-54317655 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1108849221 13:54707089-54707111 CTAGCTACTCCCTGCTGGATAGG - Intergenic
1108867141 13:54937652-54937674 CTGGCTGCTTCCTGCTGGGAAGG + Intergenic
1109274228 13:60286275-60286297 CTGGCTACTTCCTACTGAAAGGG - Intergenic
1109425152 13:62157689-62157711 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1109606530 13:64705002-64705024 GTAACTCCTTCCTGCTGAATAGG + Intergenic
1110712464 13:78664949-78664971 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
1110952780 13:81516608-81516630 CTGGCTACTTTCTGCTGAAAAGG + Intergenic
1112519725 13:100084735-100084757 CTAGCTACTTCCTGCTGTATAGG - Intergenic
1113550557 13:111189998-111190020 CTAGCTACTTCCTGCTGGATAGG + Intronic
1113691317 13:112312841-112312863 CTAGCTACATCCTGAAGGAATGG - Intergenic
1114384763 14:22243316-22243338 CTAACTGCTTTCTGCTGAATTGG - Intergenic
1114439642 14:22735905-22735927 CTGGCTATTTCCTGCTGAAAAGG - Intergenic
1114774138 14:25461755-25461777 CTGGCTGCTTCTTGCTGGATAGG - Intergenic
1114840770 14:26260117-26260139 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1115284995 14:31706209-31706231 CTAGCTACTTCCTGCTGGATAGG + Intronic
1116044921 14:39732660-39732682 CTGGCTACTTCCTGCTGAAAGGG + Intergenic
1116289072 14:43008487-43008509 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
1116326614 14:43538706-43538728 CTGGCTACTTCCTGCTGCTTAGG - Intergenic
1116446675 14:45019870-45019892 CTAACTGCTTCCTGCTGAATTGG + Intronic
1117198262 14:53362600-53362622 CTAACTGCTTCCTGCTGAACTGG - Intergenic
1117307501 14:54490616-54490638 AAAGCTACTTCCTGCTGAACAGG + Intergenic
1117568626 14:57022811-57022833 CTACCTACTTCTTGCTTCATAGG - Intergenic
1117672875 14:58125738-58125760 CTAACTGCTTCCTGCTGAATTGG - Intronic
1117861619 14:60097904-60097926 CTGGCTACTTCCTGCTGACAAGG - Intronic
1118547188 14:66904673-66904695 CTAGCTACTTCCTGCTGGAAAGG + Intronic
1119689131 14:76656961-76656983 CTGGCTACTTCCTACTGAAAAGG - Intergenic
1121097224 14:91226040-91226062 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1121154284 14:91668097-91668119 CTAGCTACTTCCTGCTGGATGGG - Intronic
1121215926 14:92247915-92247937 CTGGGTACTTCCTGCTGCAGAGG + Intergenic
1122011290 14:98751211-98751233 TTAGCTAATTTCTGTTGGATGGG + Intergenic
1123768368 15:23504167-23504189 CTGGCTACTTCCTACCGGAGAGG + Intergenic
1123868869 15:24551571-24551593 CTAGCTTCTTCCTGCTGAAAAGG + Intergenic
1124211336 15:27767313-27767335 ATTGGGACTTCCTGCTGGATAGG - Intronic
1125668031 15:41447902-41447924 TTCTCTACTTCCTTCTGGATGGG + Intronic
1126052035 15:44694923-44694945 CTGGCTACTTCATGCTGAAAAGG - Intronic
1126070610 15:44862128-44862150 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1126318382 15:47395597-47395619 ATAGCTCCTGCCTGCTGGACAGG - Intronic
1127073520 15:55305264-55305286 CTAACTGCTTCCTGCTGAACTGG + Intronic
1128362122 15:66969607-66969629 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1129525955 15:76214492-76214514 CTAAGTACTTCATGCTGGGTGGG - Intronic
1130535099 15:84778739-84778761 CTGGCTACTTCCTGCTGAAAAGG + Intronic
1131411893 15:92214291-92214313 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1131420624 15:92301796-92301818 CTAACTGCTTCCTGCTGAACTGG - Intergenic
1132997361 16:2830230-2830252 CTCGCTTCTTCCTTCTGGATGGG + Exonic
1134659284 16:15971607-15971629 CTGGCTACTTCCTGGTGAAAAGG + Intronic
1134911553 16:18031473-18031495 CTAACTGCTTCCTGATGAATTGG + Intergenic
1135145543 16:19959665-19959687 GGAGCTACTTCCTGCTGGCCAGG - Intergenic
1135339040 16:21630566-21630588 CTAGCTACTTCCTGCTGGATAGG + Intronic
1137222467 16:46469869-46469891 GTAGCTACTTCCTGCTGAAAAGG + Intergenic
1138493920 16:57395523-57395545 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1139086761 16:63596705-63596727 CAACCCACTTCCCGCTGGATGGG - Intergenic
1143125164 17:4637217-4637239 CTGACTTCTCCCTGCTGGATGGG - Exonic
1143403346 17:6659944-6659966 CTGACTTCTCCCTGCTGGATGGG + Intergenic
1144305478 17:13966058-13966080 TTAGCTACTTCCTGCTGAAAGGG + Intergenic
1144593574 17:16546004-16546026 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1145805006 17:27720385-27720407 CTACCTACTTCTTGCTGGATAGG - Intergenic
1145822251 17:27847990-27848012 GTGGCTACTTTCTGCTGAATGGG - Intronic
1145869369 17:28260791-28260813 CTGGCTGCTTCTTGCTGAATAGG - Intergenic
1146311414 17:31771256-31771278 CTAGCTACTTCCTGTGGGATAGG - Intergenic
1146769095 17:35552188-35552210 CTAACTGCTTCCTGCTGAATTGG - Intronic
1146997845 17:37336275-37336297 CTAACTGCTTCCTGCTGAATTGG - Intronic
1147922961 17:43929773-43929795 CTGGCTACTTCCTTCCGAATAGG + Intergenic
1148014486 17:44511597-44511619 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1148826795 17:50399781-50399803 CTAACTGCTTCCTGCTAAATTGG + Intergenic
1149074627 17:52580666-52580688 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1149213932 17:54332322-54332344 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1149273655 17:55011899-55011921 CTAACTGCTTCCTGCTGAACTGG + Intronic
1151567563 17:74907664-74907686 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1152074176 17:78148672-78148694 CCAGGTACTTCCTGCTCGGTCGG - Intronic
1152883381 17:82833221-82833243 CTTGCTCCTACCTGCTGGCTGGG + Intronic
1153401999 18:4691645-4691667 CTAACTGCTTCCTGCCGAATTGG - Intergenic
1153438393 18:5090398-5090420 CTAGCTACTTCCTGCTGCATAGG - Intergenic
1153553191 18:6284309-6284331 CTATCTCCTTCCTGCTGCAGAGG + Intronic
1154360623 18:13657431-13657453 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1155236724 18:23827373-23827395 CCAGACACTTCCTGCTTGATGGG + Exonic
1155475387 18:26232281-26232303 CTAGTTACTTCTTGCTGGATAGG + Intronic
1155787124 18:29915016-29915038 TTAGCTACTTCCTGCTGACAAGG - Intergenic
1156306223 18:35880288-35880310 CTAGCTACTTCTTGCTGGAGGGG - Intergenic
1157359177 18:46962936-46962958 CTGGCTGCTTCCTGCGGGCTTGG + Exonic
1157360171 18:46968863-46968885 CTGGCTGCTTCCTGCGGGCTTGG + Exonic
1157360772 18:47022455-47022477 CTGGCTGCTTCCTGCGGGCTTGG + Exonic
1157361761 18:47028370-47028392 CTGGCTGCTTCCTGCGGGCTTGG + Exonic
1157662063 18:49454143-49454165 CTGGCTACTTCCTGCTGAAAAGG - Intronic
1157856994 18:51112427-51112449 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1158016049 18:52785504-52785526 CTGGCTACTTCCTGCTGAAAGGG + Intronic
1158655666 18:59330164-59330186 TTAGTTACTTCATGCTGGCTGGG - Exonic
1158699074 18:59730364-59730386 GAAGCTACTTCCTGCTGAACAGG + Intergenic
1158786122 18:60713312-60713334 CTAACTGCTTCCCGCTGAATTGG - Intergenic
1158864439 18:61624544-61624566 CTGGCTACTTCCTGCTGACGAGG - Intergenic
1158949716 18:62482693-62482715 CTAACTGCTTCCTGCTGAACTGG - Intergenic
1160600784 18:80010972-80010994 TTGGCTACTTCCTGCTGGAAAGG + Intronic
1161597609 19:5158921-5158943 CTAGCTACTTCCTGCTGGATAGG + Intronic
1161826785 19:6572826-6572848 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1162051116 19:8033741-8033763 CTGGCTACTTCCTGCTGTTGTGG + Intronic
1162236601 19:9314561-9314583 TGGGCTACTTCCTGCCGGATAGG + Intergenic
1162667353 19:12225151-12225173 CTGGCTACTTCCTGCTGACGAGG + Intronic
1163662481 19:18587103-18587125 CTAATTGCTTCCTGCTGAATAGG - Intronic
1164005737 19:21146941-21146963 GTAACTACTTCATGCTGAATAGG + Intronic
1164027441 19:21365492-21365514 GTAACTACTTCATGCTGTATAGG + Intronic
1164057547 19:21634376-21634398 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1164064073 19:21699001-21699023 CAAGATACTTCCTGCTGAAAAGG - Intergenic
1164173999 19:22751668-22751690 CTAACTGCTTTCTGCTGAATTGG - Intergenic
1164299399 19:23947746-23947768 CTAACTGCTTCCTGCTGAACTGG - Intergenic
1164398269 19:27885216-27885238 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1164992426 19:32693911-32693933 CTAGCTACTTCCTGCTGGACAGG + Intronic
1166024771 19:40072248-40072270 CTAATTGCTTCCTGCTGAATTGG - Intronic
1166165736 19:40987084-40987106 CTAACTTCTTTCTGCTGAATGGG + Intergenic
1166247541 19:41539742-41539764 TTAGCTGCTTCCTGCTGAAAGGG - Intergenic
1166248985 19:41552673-41552695 CTGGCTACTTCCTGCTGAGAGGG + Intronic
1166426528 19:42683810-42683832 CTGGCTATTTCCTGCTGAAAAGG + Intronic
1166619662 19:44284802-44284824 CTGGCTGCTTCCTGCTGAAAGGG - Intronic
1168183110 19:54677013-54677035 CTGGCTACTTCCTGCTGAAAAGG - Intronic
1168551452 19:57299519-57299541 CTACCTAATTTCTGATGGATTGG + Intergenic
924973690 2:154357-154379 CTAACTGCTTCCTGTTGAATTGG + Intergenic
924976918 2:186120-186142 CTGGCTACTTCCTGCTGGATGGG - Intergenic
925471649 2:4168727-4168749 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
925949256 2:8895688-8895710 CTAGCTACTTCCTGCTGGATAGG + Intronic
926279865 2:11437023-11437045 CTTGCTCCTTCCTGCTCGACAGG + Intergenic
926816435 2:16802355-16802377 CTAACTGCTTCCTGCTGAATTGG + Intergenic
926864921 2:17345856-17345878 CTAACTGCTTCCTGCTGAATTGG - Intergenic
928348115 2:30519421-30519443 CTAACTGCTTCCTGCTGAACTGG - Intronic
928476681 2:31633666-31633688 CTAACTGCTTCCTGCTGAATTGG - Intergenic
928481433 2:31688211-31688233 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
928701638 2:33904134-33904156 CTAGCTACTTCCTGCTGGATAGG + Intergenic
930039114 2:47107018-47107040 CTAGCTACTTCCTGCTGGAGAGG - Intronic
930506506 2:52288095-52288117 CTGGCTACTTCCTGCTGAAAGGG + Intergenic
931540911 2:63327974-63327996 CTAGCTATTTCCTGCCGGATAGG - Intronic
932318279 2:70801034-70801056 CTGGCTTCTTCCTGCAGGACAGG - Intergenic
932673798 2:73760422-73760444 CTAACTACTTCCCGCTGGCAAGG - Intergenic
933174805 2:79163554-79163576 CTAACTGCTTCCTGCTGAACTGG + Intergenic
933342486 2:81040176-81040198 TTAGCTACTTCCTGCTGGATAGG - Intergenic
933368853 2:81389681-81389703 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
933559627 2:83874452-83874474 CTGGCTACTTCCTGCTGTTAAGG + Intergenic
933730524 2:85452825-85452847 CTAGCTACTTCCCGCTGGATAGG + Intergenic
935248010 2:101236139-101236161 CTAGCTACTTCCTGCTGGATAGG - Intronic
935529490 2:104215490-104215512 CTGGCTACTTCCTGCTGAAAGGG - Intergenic
936802883 2:116288157-116288179 CCTACAACTTCCTGCTGGATAGG - Intergenic
936899434 2:117467127-117467149 CTGGCTACTTCCAGCTGAAAAGG + Intergenic
937050477 2:118884230-118884252 CTAGCTACTTCCTGCTGGATAGG + Intergenic
937139812 2:119590386-119590408 GAAGGTGCTTCCTGCTGGATTGG - Intronic
937169787 2:119854506-119854528 CTGGCCACTTCCTGCTGAAAAGG + Intronic
937538773 2:122923788-122923810 TTAGCTACTTCCTGCTGAAAGGG + Intergenic
938153232 2:128904134-128904156 CTAGCTACTTCCTGCTGGATAGG + Intergenic
938805600 2:134804560-134804582 CTAGCTACTTCCTGCTGAATAGG + Intergenic
938944779 2:136202269-136202291 CTAACTGCTTCCTGCTAAATTGG + Intergenic
939493047 2:142899551-142899573 TTAACTGCTTCCTGCTGAATTGG + Intronic
939493218 2:142900742-142900764 CTAACTGCTTCCTGCTGAATTGG + Intronic
939852553 2:147318631-147318653 CTAGCTACTTCCTGCTGGATAGG - Intergenic
940989282 2:160081648-160081670 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
941243853 2:163072650-163072672 GTAGCTACTTCCTGCTGGATAGG - Intergenic
941991334 2:171560419-171560441 CTAACTGCTTCCTGCTGAATTGG + Intergenic
942101791 2:172590976-172590998 GTAGCTACTTCTTGCTGGATAGG + Intronic
942374830 2:175326123-175326145 CTAACTGCTTCCTGCTGAATTGG - Intergenic
942580194 2:177409633-177409655 TTAACTGCTTCCTGCTGAATTGG + Intronic
942679600 2:178463143-178463165 CTAACTGCTTCCTGCTGAACTGG - Intergenic
943102730 2:183507961-183507983 CTGGCTACTTCCTGCTGGATAGG + Intergenic
943134343 2:183892282-183892304 CTAGCTACTTCCTGCTGGATAGG - Intergenic
943283180 2:185963752-185963774 CTGGATACTTCCTGCTGAAAGGG + Intergenic
943382704 2:187171229-187171251 TTAGCTACTTCCTGCTGAAAGGG + Intergenic
943902357 2:193456295-193456317 CTAGCTACTTCCTGCTGGATAGG - Intergenic
943985275 2:194610779-194610801 CTGGCCACTTCCTGCTGAAAAGG - Intergenic
943985671 2:194614969-194614991 CTGGCCACTTCCTGCTGAAAAGG - Intergenic
944039119 2:195335063-195335085 CTAACTGCTTCCTGCTGAATTGG + Intergenic
944110243 2:196124216-196124238 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
944729541 2:202503124-202503146 CTAGCTATTTCCTGCTGGATAGG - Intronic
945030036 2:205654960-205654982 CTTCCTAGCTCCTGCTGGATGGG + Intergenic
945557725 2:211300155-211300177 CTGGCTGCTTCCTGCTGAAAGGG + Intergenic
946129028 2:217591230-217591252 CTAACTGCTTCCTGCTGAATTGG + Intronic
946206027 2:218109316-218109338 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1168740952 20:191076-191098 CTAACTGCTTCCTCCTGAATTGG + Intergenic
1168822359 20:783682-783704 CTGGCTACTTCCTGCTGATGAGG - Intergenic
1169082121 20:2803983-2804005 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1169647226 20:7826047-7826069 CTGGCTAATTCCTGCTTGAGAGG + Intergenic
1170397941 20:15947996-15948018 CTAACTGCTTCCTGCTGAATTGG - Intronic
1171261962 20:23742026-23742048 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1171271066 20:23817756-23817778 GTAGCTACTTCCTGCTGGATAGG - Intergenic
1171465804 20:25327092-25327114 CTAACTTCTTCCTGCTGGCCAGG - Intronic
1172340995 20:34157455-34157477 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1173195625 20:40911093-40911115 CTAGCTACTTCCTGCTGCATAGG + Intergenic
1174020147 20:47523296-47523318 CTGGCTACTTCCTGCTGAAAAGG + Intronic
1174324095 20:49765343-49765365 CTTGCTACTTCCTGCTGACCAGG - Intergenic
1174977669 20:55352645-55352667 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1177136061 21:17306392-17306414 CTAGCTACTAACTGCTGGATAGG - Intergenic
1177263074 21:18753580-18753602 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1177728228 21:24995014-24995036 CTGGCCACTTCCTGCTGGAGAGG - Intergenic
1177896634 21:26861191-26861213 GTAACTGCTTCCTGCTGAATTGG - Intergenic
1178451001 21:32699692-32699714 GTAGCTACTTGCTGCTGAAAAGG + Intronic
1178624689 21:34204844-34204866 GCAGCTTCTTCCTGCTGGAGAGG + Intergenic
1178837420 21:36110689-36110711 CTGGCTGCTTCCTGCTGAAAAGG - Intergenic
1178980699 21:37261880-37261902 CTACCCACATCCTGCTGGAGAGG - Intronic
1179106493 21:38405107-38405129 CTAGCTACTAACTTCAGGATAGG - Intronic
1179258683 21:39739652-39739674 CTAACTGCTTCCTGCTGGCCTGG + Intergenic
1179598840 21:42461976-42461998 CTAGCTGCTACCTGCTAGAGTGG - Intergenic
1181376270 22:22460604-22460626 CTGGCTACTTCCTTCTGGAAAGG + Intergenic
1181446715 22:22982158-22982180 CTGGCTACTTCCTGCTGAAAGGG - Intergenic
1181837229 22:25620664-25620686 CTGGCTACTTCCTGCAGAAAAGG + Intronic
1182006940 22:26968759-26968781 CTAGGTAATTCCAGCTGGTTTGG - Intergenic
1182907385 22:33949926-33949948 TTAACTGCTTCCTGCTGAATTGG + Intergenic
1183838664 22:40478900-40478922 CTGGCTCCTTCCTGCTGAAAAGG - Intronic
1184443584 22:44534232-44534254 CCTGCTACTTCCTCCTGGCTGGG - Intergenic
949609193 3:5686697-5686719 CTGGCTACTTTCTGCTGAAAAGG + Intergenic
950929170 3:16771855-16771877 CTGGCTACTTCCTGCTGAATAGG - Intergenic
951021101 3:17781573-17781595 CTAGCTACTTCCTGCTGGATAGG - Intronic
951239946 3:20275653-20275675 CTAGCTAGTTCCTGGGGGATGGG - Intergenic
951841410 3:27038115-27038137 GTAACTACTTCATGCTGGCTTGG + Intergenic
951982787 3:28583957-28583979 CTATGTACTTCCTTATGGATAGG + Intergenic
952554737 3:34519477-34519499 CTAGCTACTTCCTGCTGGATGGG + Intergenic
952749539 3:36814277-36814299 CCAGCTACTTCTTGCTGCAAGGG + Intergenic
952921776 3:38290237-38290259 CTAACTGCTTCCTGCGGAATTGG + Intronic
952940308 3:38439162-38439184 CTAGCTACTTCCTGCTGGATAGG + Intergenic
953085293 3:39659671-39659693 CTAACTGCTTCCTGCTGAATTGG - Intergenic
953597751 3:44334362-44334384 CTGGCTACTTCTTGCTGAAAGGG + Intergenic
953622370 3:44544111-44544133 CTAGCTAATTCCTGCTGGATAGG + Intergenic
954149399 3:48649960-48649982 ATAGCTCCTTCCTGCTGCTTGGG - Intronic
954231526 3:49221567-49221589 ATAGCTACTTCCTGCTGGTTAGG + Intronic
954599393 3:51856165-51856187 CTAGCAGCTTCCTGCTGGACAGG - Intergenic
955186326 3:56718672-56718694 CTAGCTACTTCCTGCTGGACAGG - Intergenic
956457841 3:69441407-69441429 CTAGTTTCTTCCTGCTGTTTGGG + Intronic
956842477 3:73153479-73153501 CTAGCTACTTCCTGCTGGATAGG + Intergenic
956999837 3:74873216-74873238 CTAACTGCTTCCTGCTGAATTGG + Intergenic
957445833 3:80311955-80311977 CTGGCTACTTTCTGCTGATTAGG - Intergenic
957716381 3:83934409-83934431 CTAGCTACTTCCTCTTGGAGAGG - Intergenic
957916291 3:86692306-86692328 CTGGCTACTTCCTGCTGGTTAGG + Intergenic
958548675 3:95589150-95589172 CTAGCTAATTCCTGCTGGATAGG + Intergenic
958601675 3:96302456-96302478 CTAGCTACTTCCTGCTGGATGGG - Intergenic
958629296 3:96667209-96667231 CTAACTGCTTCCTGCTGAATTGG + Intergenic
958750075 3:98185315-98185337 CTGGCTATTTCCTGCTGAAAGGG + Intronic
959051989 3:101533225-101533247 CTGGCTACTTTCTGCTGAAAGGG + Intergenic
959280016 3:104325540-104325562 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
959761788 3:109975003-109975025 CTAACTGCTTCCTGCTGAATTGG + Intergenic
960064073 3:113351991-113352013 CCAGCTACTTCCTGCTGGGTAGG - Intronic
960277783 3:115746646-115746668 CTAACTGCTTTCTGCTGAATTGG - Intergenic
960540012 3:118851605-118851627 CTAGCTACTTCCTGCTGAACTGG - Intergenic
960654687 3:119989917-119989939 CTGGCTACTTCCTGCTGACTAGG - Intronic
961335026 3:126170640-126170662 CTAGCTACTTCCTGCTGATGCGG - Intronic
961343199 3:126244087-126244109 TTAGCTACTTCCTGCTGACAAGG + Intergenic
961991519 3:131197255-131197277 CTAACTGCTTCCTGCTGAATTGG + Intronic
962495905 3:135938501-135938523 CTAACTGCTTCCTGCTGAAATGG - Intergenic
963021713 3:140878291-140878313 CTAGCTATTTCCTGCTGGATAGG - Intergenic
963112180 3:141696896-141696918 TTGGCTACTTCCTGCTGGGAAGG + Intergenic
963126440 3:141821124-141821146 CTAACTGCTTCCTGCTGAACTGG - Intergenic
963188469 3:142443248-142443270 CTAACTGCTTCCTGCTGAATTGG - Intronic
963641435 3:147865441-147865463 CCAACTACTTCCTGCTGGCCTGG - Intergenic
963697318 3:148577515-148577537 CTAGCTACTTCCTGCTGGATAGG - Intergenic
963762131 3:149294849-149294871 TTAGCTACTTCCTGCTGACAGGG - Intergenic
963809028 3:149756845-149756867 CTAACTGCTTCCTGCTGAATTGG + Intergenic
963916211 3:150860931-150860953 CTAACTGCTTCCTGCTGAATTGG - Intergenic
964273028 3:154978902-154978924 CTAACTGCTTCCTGCTGAACTGG - Intergenic
964953873 3:162327959-162327981 CTAACTGCTTCCTGCTGAACTGG - Intergenic
964961636 3:162435081-162435103 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
964972569 3:162579518-162579540 CTAGCTACTTCCTGCTGGATAGG - Intergenic
965139783 3:164818222-164818244 CTAGCTACTTCCTGCTGGATAGG - Intergenic
966687973 3:182716474-182716496 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
967542551 3:190684510-190684532 CTAGCTACTTCCTGCTGAAAAGG - Intergenic
967584223 3:191192173-191192195 CTAGCTACTTCCTGCTGGATAGG - Intergenic
967624006 3:191665186-191665208 CTAACTGCTTCCTGCTGAATTGG - Intergenic
967918362 3:194596294-194596316 CTCGTTACTTCCTCCTGGACTGG - Intronic
967936342 3:194730926-194730948 CTGGCTACTTCTTGCTGAAAAGG + Intergenic
969645584 4:8426941-8426963 GTAACTGCTTCCTGCTGAATTGG - Intronic
971066679 4:23040725-23040747 CCATCTACTTTCTGCTGGGTAGG + Intergenic
971209801 4:24604787-24604809 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
971280628 4:25239854-25239876 CTAGCTACTTCCTGCTGGATAGG + Intronic
971439506 4:26665031-26665053 CTAACTGCTTCCTGCTGAACTGG + Intronic
972132838 4:35859516-35859538 CTAACTACTTCCTGCTGGATAGG + Intergenic
972152224 4:36107069-36107091 CTATCTCCTTCCAGTTGGATGGG + Intronic
972216261 4:36900289-36900311 CTGGCTACTTCCTGCTGAAAGGG - Intergenic
972651432 4:41021271-41021293 CTAGCCACTTCCTGCTGGATAGG - Intronic
972780905 4:42286209-42286231 TTAACTGCTTCCTGCTGAATTGG + Intergenic
974187928 4:58464868-58464890 CTAGCTACTTCCTCCTGGATAGG - Intergenic
974527430 4:63061666-63061688 CTAGCTACTTCCTGCTGGATAGG - Intergenic
974647411 4:64713141-64713163 CTGGCTACTTCCTACTGAAAAGG + Intergenic
974838319 4:67275856-67275878 CTAGCTACTTCCTGCTGGATAGG + Intergenic
974969327 4:68804899-68804921 CTGGCTACTTCCTGATGGTTAGG - Intergenic
975004886 4:69271885-69271907 CTGACTACTTCCTGCTGGTTAGG - Intergenic
975013309 4:69380865-69380887 CTGGCTACTTCCTGCTGGTTAGG - Intronic
975595279 4:76043908-76043930 CTAGCTACTTCCTGCTGGATAGG + Intronic
976174022 4:82334382-82334404 CTAGCTACTACCTGCTGGATAGG + Intergenic
976190106 4:82479257-82479279 CTAACTGCTTCCTGCTGAATTGG - Intergenic
976464507 4:85352512-85352534 CTAACTGCTTCCTGCTGAATTGG + Intergenic
976813554 4:89121974-89121996 CTAGGTACTTCCTGCTGAAACGG - Intergenic
977617781 4:99105144-99105166 TTAACTGCTTCCTGCTGAATTGG + Intergenic
977640753 4:99355617-99355639 CTAGCTAATTCCTGCTGGATAGG - Intergenic
977752065 4:100621217-100621239 CTGGCTGCTTCCTGCTGAAAAGG + Intronic
978155893 4:105489062-105489084 CTAACTGCTTCCTGCTGAATTGG - Intergenic
978343430 4:107740722-107740744 CTGGCTACTTCCTGCTGAGAGGG - Intergenic
978498938 4:109387704-109387726 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
978895203 4:113878539-113878561 GAAGCTACTTCCTACTGAATAGG - Intergenic
978910006 4:114051411-114051433 CTAACTGCTTCTTGCTGCATTGG - Intergenic
980444673 4:132888732-132888754 CTAAATGCTTCCTGCTGAATTGG - Intergenic
980872032 4:138622595-138622617 CTAACTGCTTCCTGCTGAATTGG + Intergenic
982043520 4:151418710-151418732 CTAACCAGTTCCTGCTGGATAGG + Intronic
982114746 4:152088782-152088804 TCAGCTAATTCCTGCTGTATAGG - Intergenic
982189720 4:152841926-152841948 CTAACTGCTTCCTGCTGAATTGG - Intronic
982701702 4:158664741-158664763 CTAGCTACTTCCTGCTGGATAGG - Intergenic
982919190 4:161252400-161252422 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
983063104 4:163180002-163180024 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
983063845 4:163188165-163188187 CTGGCTACTTCCTGCTGGAGAGG + Intergenic
983084652 4:163428038-163428060 CTAGCTACTTCCTGCTGGATAGG - Intergenic
983181919 4:164657760-164657782 CTAACTGCTTCCTGCTGAACTGG - Intergenic
983694756 4:170514361-170514383 CTGGCTACTTCCTGCTGAAAGGG + Intergenic
983834327 4:172370083-172370105 CTAGCTACTTCCTTCTGGATAGG + Intronic
983915026 4:173282572-173282594 CTGGCTATTTCTTGCTGGAGAGG + Intronic
984367852 4:178821475-178821497 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
984724184 4:183003994-183004016 CTAACTGCTTCCTGCTGAACTGG - Intergenic
984918013 4:184740955-184740977 CTAGCTACTTCCTGCTGGATAGG - Intergenic
984939024 4:184915544-184915566 GTAGCTACTTCCTGCTGGATAGG + Intergenic
987818733 5:22934790-22934812 CTAGCTACTTCTTGCTGGATAGG - Intergenic
987818876 5:22936220-22936242 CTAGCTACTTCTTGCTGGATAGG + Intergenic
987931163 5:24400592-24400614 CTAGCTACTTCCTGCTGGATAGG - Intergenic
988087844 5:26494922-26494944 GAAGCTACTTCATGCTGAATAGG - Intergenic
988430118 5:31109643-31109665 CTAACTGCTTCCTGTTGAATTGG + Intergenic
988591474 5:32553381-32553403 CTAGCTACTTCCTGCTGGATAGG + Intronic
988605283 5:32673704-32673726 CTAGCTACTTCCTGCTGGATAGG + Intergenic
988856712 5:35234153-35234175 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
988956859 5:36329080-36329102 CTAACTGATTCCTGCTGAATTGG + Intergenic
989281967 5:39654894-39654916 CTGACTACTTCCTGCTGAAAAGG - Intergenic
989688365 5:44114216-44114238 CTAACTGCTTCCTACTGAATTGG - Intergenic
989957840 5:50376571-50376593 CTAGCTACTTCCTGCTGGATGGG - Intergenic
990117175 5:52403211-52403233 CTAGCTACTTCCTTCTGGATAGG - Intergenic
990367351 5:55084757-55084779 CTAGCTACTTCCTGCTGGACAGG + Intergenic
990617230 5:57520404-57520426 CTAACTGCTTCCTGCTGAATTGG + Intergenic
990892737 5:60665619-60665641 TTAACTGCTTCCTGCTGAATTGG - Intronic
991175800 5:63686533-63686555 CCATCTACTTCCTGCTGAAGAGG + Intergenic
992050270 5:72935022-72935044 CTAGCTACTTCCTGCTGGATAGG - Intergenic
993031770 5:82714419-82714441 CTAGCTACTTCCTGCTGGATAGG - Intergenic
993060738 5:83035976-83035998 CTAGCTACTGCCTGGTAGAGAGG - Intergenic
993460657 5:88177144-88177166 CTAACTGCTTCCTGCTGAACTGG + Intergenic
993590891 5:89794190-89794212 CTAACTGCTTCCTGCTGAATTGG - Intergenic
994230847 5:97309501-97309523 CTAGCTACTTCCTGCTGGATGGG + Intergenic
994448740 5:99912128-99912150 TTAGCTACTTCCTGCTGACAGGG + Intergenic
994489488 5:100423506-100423528 CTGGCTACTTCCTGCTGGAGAGG - Intergenic
994665141 5:102696347-102696369 CTGGCTACTTCCTTCTGAAAGGG - Intergenic
995125653 5:108574942-108574964 CTAACTGCTTCCTGCTGAATTGG + Intergenic
995466094 5:112450646-112450668 CTAACTGCTTCCTGCTGAATTGG - Intergenic
995582913 5:113619559-113619581 CTAGCTACTTTCTGCTGGATAGG + Intergenic
995659688 5:114467196-114467218 CTAGCTAATTCGTGCTGTTTTGG - Intronic
995681513 5:114726035-114726057 CTGGCTACTTCCTGCTGATGGGG - Intergenic
995707314 5:114999083-114999105 CTAGCTACTTCCTGCTGGATAGG - Intergenic
995714962 5:115073211-115073233 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
995738426 5:115328563-115328585 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
996681103 5:126228850-126228872 CTAGCTACTTCCTGCTGGATAGG - Intergenic
997073196 5:130641744-130641766 CTAGCTACTTCCTGCTGGATAGG - Intergenic
998112239 5:139511188-139511210 GTGGCTACTTCCTGCTGGATGGG - Intergenic
998345233 5:141456262-141456284 CTGGCTACTTCCTGCTGAAAAGG + Intronic
998712959 5:144848091-144848113 CTAGCTACTTCCTGCTGGATAGG + Intergenic
998770410 5:145537509-145537531 CTACCTAGTTCCTGTTGGAATGG - Intronic
998915536 5:147007211-147007233 CTAGCTACTTCCTGCTGAACAGG - Intronic
999361019 5:150986942-150986964 CTAGCTGCTTCCTGCTGAATAGG + Intergenic
999863887 5:155679494-155679516 TTAGCTACTTCCTGCTGAAAGGG - Intergenic
999900989 5:156086904-156086926 CTGGCTACTTCCTGCTGAATGGG + Intronic
1000068809 5:157720062-157720084 CTGGCTACTTTCTGCTGAAAAGG + Intergenic
1000085775 5:157886612-157886634 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1000625557 5:163534128-163534150 CTCACTGCTTCCTGCTGAATTGG + Intergenic
1002287061 5:178170585-178170607 CTGGCTACTTCCTGCTGAGAGGG + Intergenic
1002437441 5:179240284-179240306 CTACCTACTTCATGCTGGCACGG - Intronic
1002682389 5:180976967-180976989 TTTGCTACTTCCTGCTGGGGGGG + Intergenic
1002890842 6:1330431-1330453 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1003374541 6:5563578-5563600 CTGGCTACTTCCTGCTGAAAAGG + Intronic
1003806119 6:9727506-9727528 CTAGCTACTTCCTGCTGGACAGG - Intronic
1004237054 6:13883317-13883339 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1004473914 6:15953388-15953410 CTTGGTATTTCCTGCTGGTTAGG - Intergenic
1004532224 6:16464027-16464049 CTAGCTACTTCCTGCTGGATAGG - Intronic
1004812824 6:19278112-19278134 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1005119917 6:22378735-22378757 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1006222172 6:32500508-32500530 CTAGGTACTTCCTGCTGGATAGG - Intergenic
1006226260 6:32539061-32539083 CTAGCTACTTCCTGATGGATAGG - Intergenic
1006288865 6:33118439-33118461 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1007030787 6:38623957-38623979 CTAGCTACTTCCTGCTGGATAGG - Intronic
1007165522 6:39826088-39826110 CCAGCTTCTGCCTGCTGGCTTGG + Intronic
1008270285 6:49482444-49482466 CTAGCTACTTCCTGCTGGATGGG + Intronic
1008561792 6:52731528-52731550 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1008581881 6:52915064-52915086 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1009348750 6:62648620-62648642 CTAACTACTTCCTGGTGGAGAGG + Intergenic
1009385075 6:63078016-63078038 CAAGCTACATCCTGCTGGATAGG + Intergenic
1009407192 6:63327075-63327097 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1009471327 6:64030912-64030934 CTAGCTACTTCCTGCTGGATAGG - Intronic
1009545239 6:65011561-65011583 CTAACTGCTTCCTGCTGAACTGG - Intronic
1009683686 6:66929049-66929071 CTGGCTACTTCCTGCTAAAAAGG - Intergenic
1009739187 6:67722787-67722809 CTAGCTACTTCCTGCTGGATGGG - Intergenic
1009873085 6:69472821-69472843 CTAGCTACTTCCTGCTGGATGGG - Intergenic
1010075403 6:71791718-71791740 CTAGCTACTTCCTGCTAGATAGG - Intergenic
1010270287 6:73909729-73909751 CTAGCTACTTCCTGCTGGATGGG - Intergenic
1010563754 6:77383527-77383549 CTGGCTACTTCCTGCTGATGAGG + Intergenic
1010573348 6:77504927-77504949 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1011189157 6:84712523-84712545 TTAACTGCTTCCTGCTGAATTGG + Intronic
1011209973 6:84944904-84944926 CTAGCTGCTTCCTGCTGAATTGG - Intergenic
1011224985 6:85095833-85095855 CTAGCTAATTATTGCTGGATAGG - Intergenic
1011310186 6:85972791-85972813 CTAACTGCTTCCTGCTGAATAGG + Intergenic
1011539401 6:88414576-88414598 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1011789170 6:90879427-90879449 CTAGATTCTTCCAGCTGGGTTGG - Intergenic
1012440972 6:99262050-99262072 CTAGCTACTTCCTGCTGGACAGG + Intergenic
1013022762 6:106235404-106235426 CTAACTGCTTCCTGCGGAATTGG - Intronic
1013137936 6:107300339-107300361 TTAACTACTTCCTGCTGAATTGG - Intronic
1013543984 6:111137666-111137688 CTAACTGCTTCCTGCTGAACTGG - Intronic
1013796807 6:113897338-113897360 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1013888869 6:115001760-115001782 CTAGCTACTTCCTGCTGAACTGG - Intergenic
1013906959 6:115232377-115232399 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1013977753 6:116096235-116096257 CTAGCTACTTCCTGTGGGATAGG - Intergenic
1014199075 6:118588879-118588901 CCGGCTACTTCCTGCTGAAAAGG - Intronic
1014203130 6:118626026-118626048 CTAGCTACTTCCTGCTGGTTAGG - Intronic
1015865041 6:137719312-137719334 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1015917690 6:138234038-138234060 TTAGCTAGTTACTGCTAGATGGG + Intronic
1016181128 6:141149328-141149350 CTGGCTATTTCCTGCTGCAGAGG + Intergenic
1016184600 6:141183264-141183286 CTAGCTACTTCCTGCTGGACAGG - Intergenic
1016677922 6:146793417-146793439 GTAGCTACTTCCTGCTGGATGGG + Intronic
1017101854 6:150855823-150855845 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1017887690 6:158612348-158612370 CTGGTTACTTCCTGCTGGGTGGG + Intronic
1018761503 6:166897849-166897871 CTAACTGCTTCCTGCTGAATTGG - Intronic
1020350222 7:7211024-7211046 CTGGCTACTTACTGCTGAAAAGG + Intronic
1020787325 7:12588918-12588940 CTGGCTGCTTCTTGCTGGATAGG + Intronic
1020788417 7:12595554-12595576 CTGGCTGCTTCTTGCTGGATAGG + Intronic
1021356037 7:19654383-19654405 CTAGCTATTTCCTGCTGGATAGG + Intergenic
1021420693 7:20442224-20442246 TTAGCTACTTCCTGCTGAAAGGG - Intergenic
1021756170 7:23855245-23855267 CTAGCTACTTCCTAGTGGATGGG + Intergenic
1021794218 7:24237222-24237244 CTGGCTACTTCCTGCTGAAAGGG - Intergenic
1022418181 7:30196113-30196135 CCAACTACTTCCTGCTGGCCTGG + Intergenic
1022579821 7:31540114-31540136 CTAGCTACTTCCTGCTGATGAGG + Intronic
1022989852 7:35696187-35696209 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1023077644 7:36499751-36499773 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1023439072 7:40168279-40168301 CTAACTGCTTCCTGCTGAATTGG + Intronic
1023707320 7:42954693-42954715 CTAGCTACTTCCTATTGCAAAGG + Intergenic
1024140850 7:46461893-46461915 CTGGCTACTTCCTGTTGGAGAGG + Intergenic
1024870126 7:53955423-53955445 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1025009771 7:55386758-55386780 CCAGCTGCTTCCTGCTGACTAGG + Intronic
1025783798 7:64625572-64625594 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1025797976 7:64757714-64757736 CTAGCTACCTCCTGTGGGATAGG + Intergenic
1025805977 7:64835281-64835303 CTGGCTACTTCCTGCTGTTAAGG + Intergenic
1025819722 7:64950810-64950832 CTGGGTACTTCCTGTTGGAAAGG + Intergenic
1025859246 7:65311125-65311147 CTGGCTACTTCCTGCTGAGGGGG - Intergenic
1027791919 7:82645252-82645274 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1028146293 7:87323442-87323464 CTAGCTACTTCCTACTGGAAAGG + Intergenic
1028251110 7:88540983-88541005 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1028319253 7:89439017-89439039 ATGGCTGCTTCCTGCTGAATAGG - Intergenic
1028494348 7:91447561-91447583 CTAGCTACTTCCTGCCAGAGAGG + Intergenic
1028535089 7:91882784-91882806 CTTGCTAGTTCCTACTGTATGGG - Intergenic
1028587794 7:92468765-92468787 CTAACTGCTTCCTGCTGAATTGG + Exonic
1030213215 7:107016910-107016932 CTAGGTATTTCCTGGTGGAGTGG + Intergenic
1030337759 7:108344086-108344108 CCAACTGCTTCCTGCTGAATTGG - Intronic
1030387092 7:108877794-108877816 TTAGCTACTTCCTGCTGACAGGG - Intergenic
1030420809 7:109304227-109304249 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1030622043 7:111800808-111800830 CTGGCTACTTCCTGTTGAAAAGG - Intronic
1030843040 7:114379473-114379495 CTAACTGCTTCCTGCTGAATTGG + Intronic
1031265010 7:119570432-119570454 CTTACTGCTTCCTGCTGAATTGG - Intergenic
1031471935 7:122176731-122176753 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1032425867 7:131821665-131821687 TTAACTGCTTCCTGCTGAATTGG + Intergenic
1032722836 7:134564759-134564781 CTAGCCACTTACTGCTGGATAGG - Exonic
1032726227 7:134592172-134592194 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1032917655 7:136510272-136510294 TTAGCTACTTCCTGCTGACAGGG + Intergenic
1032933904 7:136706919-136706941 CTAGCTAATTCCTTCTGTACAGG - Intergenic
1033682105 7:143604750-143604772 GTAGCCACTTCCTTCTGGATGGG - Intergenic
1033702785 7:143857163-143857185 GTAGCCACTTCCTTCTGGATGGG + Exonic
1033758691 7:144418519-144418541 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1034249426 7:149676361-149676383 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1034311264 7:150090932-150090954 CTAGCTACTTCATGCTGTGAGGG + Intergenic
1034579308 7:152028736-152028758 GTAGCTACTTCCTGCTGGATAGG + Intronic
1034795591 7:154009711-154009733 CTAGCTACTTCATGCTGTGAGGG - Intronic
1038430061 8:27492934-27492956 CTAGCTACTTCCTGCTGGATAGG + Intronic
1038639305 8:29311204-29311226 TTTGCTACTTCCTGCTGGATAGG - Intergenic
1038982780 8:32777554-32777576 CTGGCTACTTGCTGCTGAAAGGG + Intergenic
1039276534 8:35938763-35938785 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1039692307 8:39876685-39876707 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1039980621 8:42407039-42407061 CTGGCTACTTCCTGCTGAAGAGG + Intergenic
1040527304 8:48236324-48236346 CTAACTGCTTCCTGCGGAATTGG + Intergenic
1040528122 8:48242120-48242142 CTAGCAACTTCCTGCTGGATAGG - Intergenic
1040528304 8:48243806-48243828 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1040667313 8:49650238-49650260 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1040795870 8:51289588-51289610 CTAGCTACTTCCTGCTGGATGGG + Intergenic
1040953922 8:52961142-52961164 CTAGCTAATTCCTGTTGGATGGG - Intergenic
1040970909 8:53136964-53136986 CTAGCTACTTCCTACTGGATAGG + Intergenic
1040999570 8:53437498-53437520 GTAGCTACTTCCTGCTGGATAGG + Intergenic
1041002810 8:53468368-53468390 GTAGCTACTTCCTGCTGGATAGG - Intergenic
1041663293 8:60419803-60419825 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1041826420 8:62100407-62100429 CTAAATACTTCCTGCTGGAGAGG + Intergenic
1041867673 8:62595735-62595757 CTAACTGCTTCCTGTTGAATTGG + Intronic
1042068631 8:64906040-64906062 GTAGCAATTTACTGCTGGATTGG + Intergenic
1042205654 8:66327414-66327436 CTGGCTGCTTCCTGCTGAATAGG - Intergenic
1042760292 8:72265195-72265217 CTGGCTACTTCCTACTGGAGAGG + Intergenic
1042762220 8:72283261-72283283 CTGACTACTTCCTGCTGGAGAGG - Intergenic
1042772526 8:72394842-72394864 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1042910634 8:73822197-73822219 CTAACTGCTTCCCGCTGAATTGG - Intronic
1042920331 8:73913509-73913531 CTAGCTACTTCCTGCTAGATAGG - Intergenic
1043468832 8:80541303-80541325 CTACCTACTTTCTGCTGTATAGG + Intergenic
1043490427 8:80742783-80742805 CTAACTGCTTCCTGCTGAATTGG - Intronic
1043749419 8:83916800-83916822 CTGGCTACTTCCTGCTGAATGGG - Intergenic
1044004632 8:86926254-86926276 CTAGCTACTTCCTGCTGGATAGG + Intronic
1044015462 8:87045056-87045078 CTAGATACTTCCTGATGGAGAGG + Intronic
1044456084 8:92394162-92394184 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1045096127 8:98800335-98800357 CTAACTACTTCCTGCTGGATAGG - Intronic
1045132038 8:99164020-99164042 CTAGCTACTTCCTGCTGGATAGG + Intronic
1045858877 8:106793540-106793562 CTAGCTACTTTCTGCTGGATAGG - Intergenic
1045928502 8:107598156-107598178 CTGGCTACTTCCTGCTGGTTAGG + Intergenic
1046193494 8:110830359-110830381 CTGGCTACTTCCTGCTTAAAAGG + Intergenic
1046385377 8:113502050-113502072 CTGGCTACTTCCTGCTGAGAGGG + Intergenic
1047276755 8:123411361-123411383 CTAACTGCTTCTTGCTGAATTGG - Intronic
1047443628 8:124900605-124900627 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1047698752 8:127429481-127429503 CTAGATGTTTCCTGTTGGATTGG - Intergenic
1047808484 8:128382341-128382363 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1048052359 8:130830007-130830029 CTGGCTACTTCCTGCTGAAAAGG - Intronic
1048757596 8:137755739-137755761 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1049536515 8:143185028-143185050 CCAGCATCTTCCTGCTGAATTGG + Intergenic
1049877619 8:145035797-145035819 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1050734536 9:8748116-8748138 CTAACTGCTTCCTGCTGAATTGG - Intronic
1050830172 9:10000497-10000519 CTGGCTACTTCCTGATGAAAAGG - Intronic
1050923010 9:11229640-11229662 CTGGCTACTTCCTGCTGACGAGG + Intergenic
1051965474 9:22823435-22823457 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1052056912 9:23917067-23917089 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1052160135 9:25247393-25247415 CTAGTTACTTCCTGCTGGATAGG - Intergenic
1052215341 9:25960315-25960337 CTAGCTGCTTCCTGCTGAAAAGG + Intergenic
1052290059 9:26830107-26830129 CTAGCTAATTCCTGCTGGATAGG - Intergenic
1052534821 9:29733133-29733155 CTGGCTAATTCCTGCTGAAAAGG - Intergenic
1052553514 9:29984160-29984182 CTAGCTACTTCCTGTTGATTTGG + Intergenic
1053134408 9:35641129-35641151 GTAACTGCTTCCTGCTGAATTGG + Intronic
1053137574 9:35661050-35661072 CTAGCTACTTCCTGGGAGGTGGG + Exonic
1056391893 9:86148503-86148525 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1056704476 9:88940394-88940416 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1057058399 9:91981674-91981696 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1057203553 9:93156947-93156969 CTTCCTCCTTCCTGCTGGCTGGG - Intergenic
1057347749 9:94266362-94266384 CTGGCTACTTCCTGCTGAGATGG + Intronic
1058446440 9:105059242-105059264 CTAGCTTCTTCCTGCTAGCAAGG - Intergenic
1058495975 9:105559335-105559357 CTAGTTACTTTCTTCTGGACTGG + Intronic
1059089239 9:111337775-111337797 CTAACTGCTTACTGCTGAATTGG - Intergenic
1059876492 9:118641164-118641186 CTGGCTGCTTCCTGCTGAATAGG - Intergenic
1060179173 9:121520648-121520670 CTAGCTACTTTCTACTGGAGAGG + Intergenic
1060406831 9:123376982-123377004 CCAGCCACCTCCTGCTGGCTTGG - Exonic
1060987481 9:127828167-127828189 GTATCTACTTCCTTCTAGATGGG - Intronic
1061279339 9:129588213-129588235 CTGGCTACTTCCTGCTGAAAGGG + Intergenic
1185604347 X:1359250-1359272 GTAGCTTGTTCCTGCTGGACTGG - Intronic
1186253901 X:7699551-7699573 CTAACTGCTTCCTGCCGAATTGG + Intergenic
1186262513 X:7794551-7794573 GTTGCTGCTTCCTGCTGGCTGGG + Intergenic
1186353812 X:8768733-8768755 CTGGCTACTTTCTGCTGAAAGGG + Intergenic
1187687430 X:21829576-21829598 CCAGGTATTTCCTGCAGGATGGG + Intergenic
1188098125 X:26047135-26047157 CTAGCTACTTCCTACTGGATAGG - Intergenic
1188751890 X:33914285-33914307 CTGGCTACTTCCTACTGAAGAGG - Intergenic
1189413188 X:40791669-40791691 TTAGCTACTTCCTGCTGACAGGG + Intergenic
1189632522 X:42969972-42969994 TTAGCTACTTCCTGTTGGACAGG + Intergenic
1190071824 X:47285953-47285975 CTGGCTACTTCCTGCTGAGGTGG + Intergenic
1190539372 X:51461487-51461509 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1190723167 X:53168144-53168166 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1191166593 X:57398944-57398966 CTAATTGCTTCCTGCTGAATTGG + Intronic
1191640552 X:63426919-63426941 CTGGCTGCTTCCTGCTGGATAGG + Intergenic
1191924754 X:66297460-66297482 CTAACTGCTTCCTGCTGAACTGG + Intergenic
1192225421 X:69224021-69224043 GCTGCTACCTCCTGCTGGATTGG - Intergenic
1192777422 X:74259839-74259861 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1192869763 X:75174220-75174242 CTAGCTACCTCCTGCTGGGTAGG + Intergenic
1192873102 X:75203949-75203971 CTGGTTGCTTCCTGCTGAATAGG + Intergenic
1192983493 X:76371651-76371673 GTAGCTTCTTCATGCTGGCTCGG + Intergenic
1193307145 X:79962689-79962711 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1193353467 X:80489090-80489112 TTGGCTACTTCCTGCTGAAAAGG - Intergenic
1193355267 X:80512887-80512909 CTGGCTACTTTCTGCTGGAGAGG + Intergenic
1193377733 X:80781554-80781576 CTAACTGCTTCCTGCTGAACTGG + Intronic
1193499929 X:82262986-82263008 CTGGTTACTTCCTGCTGAAAAGG + Intergenic
1193507836 X:82364527-82364549 GTAACTGCTTCGTGCTGGATTGG + Intergenic
1194104987 X:89757663-89757685 CTGGCTATTTCCTGCTGAAAAGG + Intergenic
1194436006 X:93869011-93869033 CTGGCTACTTCCTGCTGGAAAGG + Intergenic
1194492583 X:94569623-94569645 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1194533094 X:95074787-95074809 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1195440868 X:104896415-104896437 CTAGCTACTTCCTGCTGGATAGG - Intronic
1195535409 X:106003724-106003746 TTAACTGCTTCCTGCTGAATTGG - Intergenic
1195551974 X:106181667-106181689 CTAGCTACTTCCTGCTGGATAGG + Intronic
1195630670 X:107052506-107052528 CTACCTGCTTCCTGCTGAAATGG + Intergenic
1195850611 X:109278223-109278245 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1195920341 X:109977462-109977484 CTGGCTACTTCCTGCTGAAAAGG - Intergenic
1196002212 X:110797500-110797522 CTAGCTCCGTCCTGCTGCCTGGG + Intergenic
1196102275 X:111858994-111859016 CTGGCTACTTCCTGCTGATGGGG + Intronic
1196126792 X:112109808-112109830 CTAGCTACTTTCTGCTGGATAGG + Intergenic
1196489606 X:116250463-116250485 CTAGCTACTTCCTCCTGGATAGG - Intergenic
1196526894 X:116738339-116738361 CTAACTGCTTCCTGCTGAATTGG + Intergenic
1197000389 X:121432148-121432170 CTAGCTACTTCCTGCTGGATGGG + Intergenic
1197355378 X:125432719-125432741 CTGGCTACTTCCTGCTGAAAAGG + Intergenic
1197384095 X:125782349-125782371 CTGTCTACTTCCTGCTGGAGAGG + Intergenic
1198766074 X:140080417-140080439 CTAACTGCTTCCTGCTGAATTGG - Intergenic
1199033375 X:143026601-143026623 CTGGCTGCTTGCTGCTGAATAGG + Intronic
1199075088 X:143516787-143516809 CTGGCTGCTTCCTGCCGAATAGG - Intronic
1199214261 X:145248164-145248186 CTGGCTGCTTCCTGCCGAATAGG + Intronic
1199281384 X:146004077-146004099 CTAGATACTTCCTGCTGATTAGG + Intergenic
1199536231 X:148906312-148906334 CTAACTGCTTCCTGCTGAACTGG - Intronic
1200456953 Y:3405452-3405474 CTGGCTATTTCCTGCTGAAAAGG + Intergenic
1200776869 Y:7177187-7177209 GTAGCTACTTCCTGCTGGATAGG - Intergenic
1200822584 Y:7602205-7602227 CTGGCTACTTCCTGCTGATGCGG + Intergenic
1200880289 Y:8205580-8205602 CTAGCTACTTCTTGTTGGATGGG + Intergenic
1200960070 Y:8988329-8988351 GTAGCTACTTCCTGCTGGATAGG - Intergenic
1201271651 Y:12261528-12261550 CTAGCTACTTCCTGCTGAATAGG + Intergenic
1201337741 Y:12898359-12898381 CTAGCTACTTCCTGCTGGAGAGG - Intergenic
1201353188 Y:13069054-13069076 CTGGCTACTTCCTGCTGACAGGG - Intergenic
1201354737 Y:13084833-13084855 GTAACTACTTCATGCTGGCTTGG + Intergenic
1201404579 Y:13636697-13636719 GTAGATACTTCCTGCTGGATAGG - Intergenic
1201430430 Y:13896976-13896998 CTAGCTACTTCCTGCTGGACAGG - Intergenic
1201469028 Y:14314229-14314251 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1201471585 Y:14341099-14341121 CTAGCTACTTACTGCTGAACTGG + Intergenic
1201488063 Y:14512553-14512575 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1201495792 Y:14590407-14590429 TTGGCTACTTCCTGCTGCATAGG + Intronic
1201515350 Y:14814267-14814289 CTACCTACTTCCTGATGGATAGG + Intronic
1201531317 Y:14992096-14992118 CTAGCTACTTCATGCTGGATGGG - Intergenic
1201556241 Y:15267036-15267058 CTAGCTGCTTCCTGCTGGATAGG - Intergenic
1201568105 Y:15387152-15387174 CTAGCTACTTCCGGCTGGATGGG + Intergenic
1201572935 Y:15433582-15433604 CTAGCTACTTCCTGCTGGATAGG - Intergenic
1201639543 Y:16164607-16164629 CTGGCTACTTCCTGCTTGTTAGG + Intergenic
1201648459 Y:16261049-16261071 CCAGCTACTTCCTGCTGGATAGG + Intergenic
1201650252 Y:16276880-16276902 CTAGCTATTTCCTGCTGGACAGG - Intergenic
1201654351 Y:16324252-16324274 CCAGCTACTTCCTGCTGGATAGG - Intergenic
1201663270 Y:16420717-16420739 CTGGCTACTTCCTGCTTGTTAGG - Intergenic
1201729099 Y:17186207-17186229 CTAGCTACTTCCTGTTGGATAGG + Intergenic
1201743585 Y:17348145-17348167 CTAGCTAATTCCTGCTGGACAGG + Intergenic
1201770686 Y:17614581-17614603 CTGGCTACTTCCTGCTGTTAAGG - Intergenic
1201830869 Y:18291405-18291427 CTGGCTACTTCCTGCTGTTAAGG + Intergenic
1201907523 Y:19100884-19100906 CTATCTACTTCCTGTTGGATAGG + Intergenic
1201911809 Y:19140222-19140244 CTAGTTACTTCCTACTGGACAGG - Intergenic
1201919813 Y:19222174-19222196 GTAGCTACTGCCTGCTGGATAGG - Intergenic
1201939625 Y:19445945-19445967 TTGGCTACTTCCTGCTGAAATGG - Intergenic
1201981462 Y:19914446-19914468 CTGGTTACTTCCTGCTGGTTAGG + Intergenic
1201989254 Y:20006980-20007002 CTAGCTACTTCCTGCTGGATAGG + Intergenic
1202074315 Y:21023091-21023113 CTAGCTACTTCTTGCTGGATAGG + Intergenic
1202104541 Y:21348975-21348997 CTGGCTACTTCCTGCTGATAGGG + Intergenic
1202258407 Y:22943766-22943788 CTAGCTACTTCCTGCTAGATAGG - Intergenic
1202411397 Y:24577524-24577546 CTAGCTACTTCCTGCTAGATAGG - Intergenic
1202459386 Y:25092548-25092570 CTAGCTACTTCCTGCTAGATAGG + Intergenic