ID: 983084653

View in Genome Browser
Species Human (GRCh38)
Location 4:163428043-163428065
Sequence CTGTTCTAGCTACTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983084653_983084655 7 Left 983084653 4:163428043-163428065 CCAGCAGGAAGTAGCTAGAACAG No data
Right 983084655 4:163428073-163428095 TCAATTCGCAACTGCAGTTAGGG No data
983084653_983084657 25 Left 983084653 4:163428043-163428065 CCAGCAGGAAGTAGCTAGAACAG No data
Right 983084657 4:163428091-163428113 TAGGGTGTCCTATTTAGAGAGGG No data
983084653_983084658 26 Left 983084653 4:163428043-163428065 CCAGCAGGAAGTAGCTAGAACAG No data
Right 983084658 4:163428092-163428114 AGGGTGTCCTATTTAGAGAGGGG No data
983084653_983084656 24 Left 983084653 4:163428043-163428065 CCAGCAGGAAGTAGCTAGAACAG No data
Right 983084656 4:163428090-163428112 TTAGGGTGTCCTATTTAGAGAGG No data
983084653_983084654 6 Left 983084653 4:163428043-163428065 CCAGCAGGAAGTAGCTAGAACAG No data
Right 983084654 4:163428072-163428094 CTCAATTCGCAACTGCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983084653 Original CRISPR CTGTTCTAGCTACTTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr