ID: 983084657

View in Genome Browser
Species Human (GRCh38)
Location 4:163428091-163428113
Sequence TAGGGTGTCCTATTTAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983084653_983084657 25 Left 983084653 4:163428043-163428065 CCAGCAGGAAGTAGCTAGAACAG No data
Right 983084657 4:163428091-163428113 TAGGGTGTCCTATTTAGAGAGGG No data
983084652_983084657 30 Left 983084652 4:163428038-163428060 CCTATCCAGCAGGAAGTAGCTAG 0: 131
1: 96
2: 63
3: 198
4: 326
Right 983084657 4:163428091-163428113 TAGGGTGTCCTATTTAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983084657 Original CRISPR TAGGGTGTCCTATTTAGAGA GGG Intergenic
No off target data available for this crispr