ID: 983090112

View in Genome Browser
Species Human (GRCh38)
Location 4:163493420-163493442
Sequence ACAGCTGCACACACATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983090108_983090112 2 Left 983090108 4:163493395-163493417 CCTAGCCAACTACCCTCAACTGT No data
Right 983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG No data
983090105_983090112 29 Left 983090105 4:163493368-163493390 CCAATTATTTGTTCAAAACGCCA No data
Right 983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG No data
983090110_983090112 -10 Left 983090110 4:163493407-163493429 CCCTCAACTGTTAACAGCTGCAC No data
Right 983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG No data
983090107_983090112 9 Left 983090107 4:163493388-163493410 CCAAGGACCTAGCCAACTACCCT No data
Right 983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG No data
983090109_983090112 -3 Left 983090109 4:163493400-163493422 CCAACTACCCTCAACTGTTAACA 0: 1
1: 0
2: 2
3: 10
4: 133
Right 983090112 4:163493420-163493442 ACAGCTGCACACACATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983090112 Original CRISPR ACAGCTGCACACACATATCA AGG Intergenic
No off target data available for this crispr