ID: 983092829

View in Genome Browser
Species Human (GRCh38)
Location 4:163525190-163525212
Sequence TAAGGGTCCTGGGGCTGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983092829_983092834 -7 Left 983092829 4:163525190-163525212 CCACCTCAGCCCCAGGACCCTTA 0: 1
1: 0
2: 2
3: 36
4: 372
Right 983092834 4:163525206-163525228 ACCCTTATAATGTCCCTTAATGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983092829 Original CRISPR TAAGGGTCCTGGGGCTGAGG TGG (reversed) Exonic
900129421 1:1081157-1081179 GAAGTGTCCTGGGGCTGGGAGGG - Intergenic
900481184 1:2900145-2900167 TCAGGGTCCTAGATCTGAGGAGG + Intergenic
900630511 1:3632702-3632724 TAAGGGTACTGACGCTGAGGTGG - Intronic
900867891 1:5281582-5281604 CAAGGGTCCTGGGGGTTAGGGGG + Intergenic
901769767 1:11524306-11524328 TGAGTGTCCAGGGGCAGAGGTGG + Intronic
902368042 1:15990127-15990149 TGAGGGTCCTGGGGCTGAACCGG + Intergenic
902526242 1:17059518-17059540 TAAGGGTCATGGGGCTATTGGGG + Intergenic
902629627 1:17696954-17696976 TGAGGGGCCCCGGGCTGAGGAGG + Exonic
902785830 1:18732016-18732038 TGAGGTCCCTGGGGCTGAGGGGG - Intronic
902880458 1:19368778-19368800 TCAGTGTCTGGGGGCTGAGGTGG - Intronic
904266779 1:29322889-29322911 GAGGGGTCCTGGGGCAGAAGTGG + Intronic
905308705 1:37035193-37035215 CACAGGTCCTGGGGCTGCGGAGG + Intergenic
905347661 1:37322249-37322271 TGAGGACTCTGGGGCTGAGGAGG - Intergenic
906110967 1:43321717-43321739 TGAGGAGACTGGGGCTGAGGTGG + Intronic
907320479 1:53599088-53599110 TGAGGGGCCTGGGGCTGAGCTGG + Intronic
907507979 1:54935731-54935753 TCAGTGTCCTCAGGCTGAGGTGG + Intergenic
908401349 1:63774794-63774816 TGAGGGTCCTGGGGGTGATCGGG + Intronic
911873233 1:103126825-103126847 TCTTGGTCATGGGGCTGAGGTGG - Intergenic
912720826 1:112018647-112018669 TACAGGGCTTGGGGCTGAGGAGG - Intergenic
913013961 1:114713971-114713993 TAAGAATCCTGGGGGTGTGGAGG + Exonic
913565695 1:120069907-120069929 GAAGGGGCGTGGGGGTGAGGGGG + Intergenic
913632434 1:120723647-120723669 GAAGGGGCGTGGGGGTGAGGGGG - Intergenic
914512342 1:148345240-148345262 CAAGGCTCCTGGGTCTGGGGCGG + Intergenic
914547319 1:148680023-148680045 GAAGGGGCGTGGGGGTGAGGGGG + Intergenic
914932981 1:151950854-151950876 TGAGGGCCCTGGGGCCAAGGGGG + Intergenic
914940017 1:152014343-152014365 CAAGGCTCCTGGGTCTGGGGCGG - Intergenic
915460948 1:156070337-156070359 GAAAGGTCCTGGGGCTGAAGTGG - Exonic
915489296 1:156242502-156242524 TGAGGGCCCTGGGGATGAGCTGG + Intronic
916123397 1:161549117-161549139 TTGGGCTCCTGGGGCAGAGGAGG - Intronic
916133289 1:161630475-161630497 TTGGGCTCCTGGGGCAGAGGAGG - Intronic
916853456 1:168726926-168726948 TGAGGGTGCCGGGGCTGTGGAGG - Intronic
918658068 1:187053845-187053867 TAAGGGTTCAGGGGCTCATGAGG + Intergenic
919020646 1:192101003-192101025 TAAGGGTTCAGGGGCTCATGAGG + Intergenic
921375264 1:214466780-214466802 CAAGTGTCTTGGGGCTCAGGGGG - Intronic
921786299 1:219233967-219233989 TATGGGTGATGGGGCAGAGGAGG + Intergenic
922098603 1:222463489-222463511 GAAGGTTCCCGGAGCTGAGGAGG + Intergenic
923246311 1:232136274-232136296 CACGGGACCTGGGGCTGGGGTGG + Intergenic
1063155805 10:3378516-3378538 CAAGGGTCCAGGGCCTCAGGGGG - Intergenic
1064671119 10:17714736-17714758 TATGGTTGCTGTGGCTGAGGTGG - Exonic
1065289221 10:24213481-24213503 TAAGGGTACAGAGACTGAGGGGG - Intronic
1065625657 10:27626003-27626025 TGAGGGGCATGGGGCTGGGGAGG + Intergenic
1065672065 10:28130302-28130324 TAAGGAACCTGAGGCTGAGATGG + Intronic
1065866109 10:29916845-29916867 CAAGAGTCCAGGGGCAGAGGAGG - Intergenic
1065963193 10:30750731-30750753 ACAGGGTCCTGGGGGTGTGGGGG + Intergenic
1066101323 10:32121251-32121273 GAGAGGTCCTGGGGTTGAGGGGG + Intergenic
1070144058 10:73760811-73760833 TCAGGGTCCAGGCGCTTAGGAGG - Exonic
1070712043 10:78689872-78689894 GAATGGTCCTGGGGCTGGGCTGG - Intergenic
1071150040 10:82623238-82623260 TAAGGATTCTGAAGCTGAGGTGG + Intronic
1073483820 10:103804235-103804257 TTAGGGTGCCCGGGCTGAGGAGG + Intronic
1075394769 10:122119385-122119407 GGAGGGTCCAGGGGCTTAGGTGG - Intronic
1075567599 10:123515877-123515899 GAAGGGAGCTGGGGCTGAAGGGG - Intergenic
1076490549 10:130858555-130858577 TAACGGGCCAGGGGCTGAAGTGG + Intergenic
1076674800 10:132142292-132142314 TAAGGGTCCTGGGGGAGGCGGGG + Intronic
1077057172 11:599806-599828 GCAGGGTCCTGGGGCTCCGGGGG + Intronic
1077093058 11:788273-788295 CAAGGGTCCTGGGGACGGGGCGG - Exonic
1077371916 11:2186283-2186305 GAGAGGCCCTGGGGCTGAGGGGG - Intergenic
1077423724 11:2464775-2464797 TAGGTGGGCTGGGGCTGAGGCGG + Intronic
1078171627 11:8932924-8932946 GAAGGAGCCTGAGGCTGAGGTGG - Exonic
1079234958 11:18681580-18681602 TCAGGGTCCTGGGGCTTGGTGGG + Intergenic
1079527944 11:21413338-21413360 CAAGGGTGCTGGGGGTGGGGGGG + Intronic
1080268499 11:30425730-30425752 TCAGGGTCCCAGGGCTGAGCAGG - Intronic
1081019735 11:37930774-37930796 TAAGGGACCTAGGGCTGTGCAGG + Intergenic
1082808052 11:57462347-57462369 TGAGGGGGCAGGGGCTGAGGAGG - Intronic
1083808431 11:65088551-65088573 GAAGGGTACTGGGGCTCATGGGG - Intronic
1083962137 11:66020497-66020519 TAAGGGTCCCAGGGGAGAGGAGG + Intronic
1084486989 11:69454279-69454301 TAATGTCCCTGGGGCAGAGGTGG - Intergenic
1084504891 11:69559351-69559373 AAAGAGCCCTGGGGCTGAAGGGG + Intergenic
1085388338 11:76169766-76169788 TCAGGGCCCTGGGGCTGTGGGGG + Intergenic
1085985991 11:81789014-81789036 TTAGGGTCTTAGGGCTGTGGAGG + Intergenic
1088434188 11:109792635-109792657 TAAGTCTTCTGGGGATGAGGAGG - Intergenic
1088693902 11:112349956-112349978 GGAGGGACCTGGGGCTGAGAGGG + Intergenic
1088907899 11:114168791-114168813 CAAGGGTCCTGGGGGTGGGGAGG + Intronic
1089354055 11:117838264-117838286 TCAGGTTCCAGAGGCTGAGGAGG + Exonic
1089443444 11:118533773-118533795 TGAGGGTCCTGGGTCTGAAAGGG + Intronic
1089456708 11:118629964-118629986 TCTGGGTCCTGGGGCAGGGGTGG + Intronic
1089512504 11:119008901-119008923 TAAGGGACCTAGGGCTGTGTAGG - Intronic
1089624114 11:119740497-119740519 TATGGGACTTGGGCCTGAGGCGG + Intergenic
1089627752 11:119762339-119762361 CCAGGGTCCTGGGGTAGAGGAGG + Intergenic
1090068947 11:123527050-123527072 AAAGGCTCCTTGGACTGAGGAGG + Intronic
1090205093 11:124879562-124879584 GAACAGTCCTGGGGGTGAGGGGG + Exonic
1090924372 11:131236504-131236526 TAAGGGCACTGGGGCTGAGACGG - Intergenic
1091161572 11:133426574-133426596 TCGGGGGCCTGGGGCAGAGGAGG - Intronic
1091355933 11:134937716-134937738 TCAGGCTCCTGGGGCTGGGCTGG + Intergenic
1091728760 12:2864543-2864565 CAAAGCTCCTGGGGCTGAGAAGG - Intronic
1092240027 12:6830556-6830578 TAAGGGTCCCGTGTGTGAGGGGG + Intronic
1092522134 12:9286003-9286025 GAAAGGTCCAGGGGCTGATGAGG + Intergenic
1092545148 12:9445853-9445875 GAAAGGTCCAGGGGCTGATGAGG - Intergenic
1093584010 12:20816342-20816364 AAAGGGTCATGGGGGTGTGGGGG - Intronic
1094507799 12:31076196-31076218 GAAAGGTCCAGGGGCTGATGAGG + Intronic
1096239747 12:49953497-49953519 TAAGGGCCCTGGAGCTGTGTTGG - Intronic
1096545868 12:52339935-52339957 TCAAGGGCCTGGGGCTGAGGCGG + Intergenic
1096748018 12:53741139-53741161 TCAGGGTCCGGGGTCTGAGATGG + Intergenic
1097168067 12:57096235-57096257 TGAGGGTGATGGGGCTGAGCAGG - Exonic
1099050157 12:77772129-77772151 TGAGGGTACTGGGGCTTAGAAGG + Intergenic
1099373033 12:81861433-81861455 TTAGGGTACTGGGGGTAAGGAGG - Intergenic
1101370747 12:104127787-104127809 TAGGGGGCTGGGGGCTGAGGTGG - Intronic
1102985234 12:117272526-117272548 TCAAGGACCTGGGGCTGAAGTGG - Exonic
1104874116 12:132021228-132021250 GAGGGGGCCTGGGGCTGGGGCGG - Exonic
1105849756 13:24323295-24323317 CAAGGGTCCTGGGGACGGGGCGG + Intergenic
1107993934 13:45842454-45842476 TCAGGGTGGAGGGGCTGAGGTGG - Intronic
1108667264 13:52645174-52645196 TGAGTGTACTGAGGCTGAGGTGG - Intergenic
1110241223 13:73269177-73269199 TAAGAGTCCAAGGGTTGAGGAGG + Intergenic
1111965943 13:94861872-94861894 TCAGGGACCTGGGGCAGAAGTGG + Intergenic
1113914231 13:113861353-113861375 TCAGGATCCTGGGCCTGGGGAGG + Intronic
1115650471 14:35399234-35399256 TAAGGAGGCTGGGGATGAGGGGG + Intergenic
1117145803 14:52835892-52835914 AAAGGGTACTGGGCCTGGGGTGG + Intergenic
1117958300 14:61139207-61139229 TGAGGGTGAGGGGGCTGAGGTGG + Intergenic
1118315471 14:64723220-64723242 TAAGGATCCAGGGGCAGAAGAGG - Intronic
1118364646 14:65084060-65084082 AAATGGTCCTGTGGCTGGGGAGG - Intronic
1119380103 14:74223136-74223158 GAATGGGCCTGGGGCCGAGGAGG - Intergenic
1119632587 14:76246461-76246483 TAAGGGTGATGGTGGTGAGGGGG + Intronic
1119737476 14:76992678-76992700 TAAGGGACCTAGTGCTGGGGAGG + Intergenic
1119933028 14:78566466-78566488 TAAGTGTGCTGGGGCTGGGTGGG + Intronic
1121174055 14:91877276-91877298 TGAGGATCCTGAGGCTCAGGAGG + Intronic
1121428632 14:93871827-93871849 CAAGTGTCCTGGGGGTGAGCTGG + Intergenic
1122852951 14:104546648-104546670 CAGGGGACCTGGGGATGAGGGGG + Intronic
1122852962 14:104546673-104546695 CAGGGGACCTGGGGATGAGGGGG + Intronic
1122852973 14:104546698-104546720 CAGGGGACCTGGGGATGAGGGGG + Intronic
1123044167 14:105503298-105503320 TGAGGGGCCTGGGGCTGGTGAGG + Intergenic
1123098240 14:105776477-105776499 GCAGGGCCCTGGGGCTGAGCAGG + Intergenic
1124142996 15:27093932-27093954 GAATGGTCATGGGGCTGAGAAGG - Intronic
1124389790 15:29244082-29244104 CAATGGTCCTGGTGCTGAGAAGG - Intronic
1124612678 15:31218745-31218767 GAAGGGTCCTGGGGTTTGGGGGG + Intergenic
1126466135 15:48963154-48963176 TAAGGGGCCGGGAGCCGAGGTGG - Exonic
1127188456 15:56505554-56505576 CAAGGGACCTGGGGGAGAGGTGG + Intergenic
1128135612 15:65261102-65261124 CAAGCCTCCTGGTGCTGAGGGGG + Intronic
1128246871 15:66138932-66138954 TTAGGGTCCTGGGCCTGATAAGG + Intronic
1128333769 15:66773189-66773211 CAAAGGTGCTGGAGCTGAGGTGG + Intronic
1128983518 15:72202845-72202867 AAAGGGTCCTGTGGCTCAGTAGG - Intronic
1129191333 15:73939320-73939342 CAAGGATCCTGAGGGTGAGGCGG + Intronic
1129263777 15:74383250-74383272 GAAGGGTCCCAGGGCTGATGGGG - Intergenic
1131732434 15:95296353-95296375 TGAGAGTCCTGAGGCTGGGGTGG + Intergenic
1132238624 15:100240309-100240331 GAAGGCATCTGGGGCTGAGGAGG - Intronic
1132322094 15:100933010-100933032 TAAGAGTCCTGGGTGGGAGGCGG - Intronic
1132677903 16:1128253-1128275 TGGGGGTCCTGGGGCTGGAGGGG + Intergenic
1132937451 16:2488298-2488320 GAAGGCTGCTGGGGCTGTGGCGG + Intronic
1134023495 16:10937894-10937916 TAAGGGTCCTGGGGCTGGGAAGG + Intronic
1134168096 16:11946458-11946480 TAAGGAGGCTGAGGCTGAGGTGG + Intronic
1135238019 16:20776514-20776536 TAAGGGTGGTGGGGCCCAGGAGG + Intronic
1135880457 16:26250611-26250633 TAAGGGTCCTATGCCTGAGAAGG + Intergenic
1137364475 16:47848892-47848914 TAAGGACCCTGGGGCTCCGGTGG - Intergenic
1138578482 16:57923916-57923938 TAGGGAGCCTGGGGCTCAGGAGG - Intronic
1139187800 16:64827721-64827743 GAAGTGTCCTGTGGCTGGGGTGG - Intergenic
1139916050 16:70429093-70429115 TCAGGCTCCTGCAGCTGAGGGGG - Intronic
1140449765 16:75061292-75061314 GAAGGGTACTGGGGGTGTGGGGG - Intronic
1142245405 16:88968054-88968076 GACGGGTCATGGGGCTGAGTTGG + Intronic
1142806763 17:2375519-2375541 TCAGGGTCCTGGGGCTCCGGGGG - Exonic
1142866500 17:2794617-2794639 TCAGGGTCCTGGGCCAGAGCAGG - Intronic
1142957702 17:3532576-3532598 TAAGGCCCCCGGGGCTGAGAGGG + Intronic
1143014096 17:3882636-3882658 TAAGGGTTCTGGGGCTGGCAAGG - Intronic
1143597100 17:7921785-7921807 CAAGGAACCTGTGGCTGAGGGGG - Intergenic
1146273354 17:31498620-31498642 TGAGGGTTCTGTGGCAGAGGAGG + Intronic
1148339861 17:46866971-46866993 TAGGAGGCCTGGGGGTGAGGAGG - Intronic
1148756066 17:49973539-49973561 GAAGGCTCCTGGGGCTGTGGGGG + Intronic
1149527499 17:57367943-57367965 TAGGGTTCCTGGGTCTTAGGTGG + Intronic
1149781160 17:59397584-59397606 TAAGGGTCCTGGCGCGGGGAAGG + Exonic
1150483585 17:65529151-65529173 TCAGGGCCCTGGGCCTGGGGAGG + Exonic
1150490637 17:65572100-65572122 TTCGGGTCAGGGGGCTGAGGTGG + Intronic
1150769823 17:68031529-68031551 AAAGGGGCCTGGAGCTGAGCTGG - Intergenic
1151765885 17:76132876-76132898 TCTGGGTCCTGGGGCGGGGGAGG + Intergenic
1152757599 17:82093427-82093449 GAAGGGTGCTGCGGCTCAGGTGG + Intronic
1157863259 18:51160316-51160338 AAGGAGTCCTGGGGCAGAGGGGG - Intergenic
1158578611 18:58661729-58661751 TCAGAGTCATGGGGCTGGGGGGG - Intergenic
1160772501 19:839268-839290 TCAGGGGGCTGGGGCAGAGGGGG + Intergenic
1160806065 19:992689-992711 TGAGGGTCTTGGGGCTGGGGTGG - Intronic
1160873547 19:1287285-1287307 TGGGGGTCCTGGGGCTCGGGAGG + Intronic
1161264384 19:3357754-3357776 TTAGGTACCTGGGGGTGAGGAGG - Intergenic
1161315671 19:3616146-3616168 CAAGGGCCCTGGGGCTGCGTGGG + Intronic
1161328530 19:3675072-3675094 CATGGGTGCTGGGGCTGGGGAGG + Intronic
1161977183 19:7613186-7613208 GGAGGGTCCTGGGCCTGGGGCGG + Intronic
1162261414 19:9537383-9537405 TAGGGGTCCTAGGGCTGACTAGG + Intronic
1162772091 19:12955334-12955356 TAATGGTCATCTGGCTGAGGAGG + Intronic
1163251246 19:16127598-16127620 TCAGGCCCCTGGGGCAGAGGAGG - Intronic
1163441263 19:17323740-17323762 GACGGGCCCTGGGGCTGCGGGGG - Exonic
1163506147 19:17707554-17707576 TTAGGTCCCTGGGGCTGTGGGGG - Intergenic
1163606423 19:18278312-18278334 GAAGGGAACTGAGGCTGAGGTGG - Intergenic
1163862617 19:19750130-19750152 TGATGGTCCTGGGGCTGTGTAGG - Intergenic
1163919605 19:20276296-20276318 GAAGGGTACTGAGGCTGAGCTGG + Intergenic
1165797672 19:38528297-38528319 TAAGGGTGCTCGGTCTGGGGAGG - Exonic
1165958949 19:39518803-39518825 TGGGGGTCCTGGGGGAGAGGGGG + Intronic
1166248005 19:41544786-41544808 TAAGGGACCTAGGGCTGTGCAGG + Intergenic
1166364974 19:42273766-42273788 TAGGGGTGCTGGCGCTCAGGTGG - Intronic
1166390714 19:42407461-42407483 TCACTGTCCTGGGGGTGAGGAGG + Exonic
1166774213 19:45302712-45302734 TAAGGGCCCTGGGACCGTGGTGG - Exonic
1167521662 19:49959275-49959297 TCAGGGTCCCAGAGCTGAGGGGG - Intronic
1167669015 19:50839042-50839064 TGAGGGAGCTGGGGCTGGGGAGG + Intergenic
1167756346 19:51415813-51415835 TCAGGGTCCCAGAGCTGAGGGGG - Intronic
1168269323 19:55241159-55241181 TGAGGGTTCGGGGGCTGGGGTGG - Intronic
1168578205 19:57531230-57531252 TAATCATCCTGGGCCTGAGGTGG - Intronic
1168719605 19:58547719-58547741 TGTGGGTTCTGGGGCTGTGGGGG + Intronic
925037682 2:703348-703370 TAAGGGACCTAGGGCTGTGTAGG - Intergenic
925162803 2:1697828-1697850 GAAGGGTCCTGCAGCTGCGGAGG - Intronic
927213272 2:20651437-20651459 AAATGGTCTTGGGGCAGAGGGGG - Intergenic
928081631 2:28317222-28317244 TAAGCGTCCTGCGGTTGAGATGG + Intronic
928420936 2:31137664-31137686 CGAGGGTCCCGGGGCGGAGGGGG - Intronic
928465080 2:31515840-31515862 CAAAGATCCTAGGGCTGAGGGGG + Intergenic
929437251 2:41938300-41938322 TAAGGGCCCAGGAGCTGAGCAGG - Exonic
932217224 2:69974842-69974864 GAAGAGTCCCTGGGCTGAGGAGG + Intergenic
932503814 2:72209399-72209421 TCAGGTTTCTGAGGCTGAGGTGG + Intronic
932713321 2:74083537-74083559 TGAGGATCCTGTGGCTGAGTTGG + Intronic
932769606 2:74493141-74493163 GAAGGGTCCTGGGGCTTGAGAGG - Exonic
934542947 2:95191548-95191570 TAAGGGACCTAGGGCTGTGCAGG + Intergenic
934939862 2:98492879-98492901 TAAGGAGCCTGGGGCTGGAGGGG + Intronic
935413353 2:102788605-102788627 TAAGGAGCCTGGGGGTTAGGAGG - Intronic
935656133 2:105425235-105425257 TAAGGGACCTAGGGCTGTGCAGG + Intronic
936028695 2:109054008-109054030 TCAGGGTTATGGGGCTGAGGCGG + Intergenic
938061931 2:128261450-128261472 AGGGGGACCTGGGGCTGAGGTGG + Intronic
938246488 2:129781263-129781285 GAATGGTCCTGGCTCTGAGGAGG + Intergenic
938675920 2:133633730-133633752 CAAGGGGCATAGGGCTGAGGGGG + Intergenic
939447035 2:142323331-142323353 TAAGAGTGCTGTGGCTGAGGAGG - Intergenic
940895742 2:159080714-159080736 TCAGGCTCCAGGGGCAGAGGAGG - Intronic
941848194 2:170152289-170152311 TAAGGGCCCAGTGGCTGAGGGGG + Intergenic
944412922 2:199459628-199459650 TCGGGGTCCTGGGGATTAGGAGG - Intronic
947001034 2:225456572-225456594 TAAGGGTTCAGGGGCTGGTGAGG + Intronic
948459871 2:238123885-238123907 TGAGGGTCCTGGAGGGGAGGTGG + Intronic
1169213599 20:3781328-3781350 GAAGGGTCGTGAGGCTGGGGCGG - Exonic
1169872672 20:10264153-10264175 TTAGGGTGCTGGGTCTGGGGAGG - Intronic
1169905742 20:10601495-10601517 TAATGGTCCCGGGGCGCAGGTGG + Intronic
1170567640 20:17615876-17615898 TCAGGGCCCAGGGGCTGATGGGG + Intronic
1170972177 20:21126206-21126228 TAAGGGCACTGGGGCGGGGGTGG + Intronic
1171121785 20:22575128-22575150 CAAGGGTGCAGGGACTGAGGGGG + Intergenic
1172011671 20:31849394-31849416 TAAGGGTGCTGGGCATGAAGTGG - Intronic
1172792997 20:37519123-37519145 TGAGGGGCTTGGGGATGAGGAGG + Exonic
1172995764 20:39069445-39069467 TGAGGGTGGTGGGACTGAGGTGG + Intergenic
1173170865 20:40722505-40722527 GAAGTCTTCTGGGGCTGAGGGGG - Intergenic
1173557903 20:43980374-43980396 GAAGGGTAGTGGGGCAGAGGGGG + Intronic
1174531807 20:51220253-51220275 GAAGGGTGCTCGGGCTGTGGGGG + Intergenic
1174604038 20:51747609-51747631 TAACAGTCATGGGGCAGAGGAGG - Intronic
1175695206 20:61098043-61098065 TAATAGTGCTGGGGGTGAGGGGG - Intergenic
1175734891 20:61378319-61378341 TGAGGTTCCTGGGGCTGCTGTGG + Intronic
1175804671 20:61820851-61820873 AGAGGGTCCTGGGCCTGAAGGGG - Intronic
1175870373 20:62206514-62206536 TGGCGGTCCTCGGGCTGAGGAGG + Intergenic
1176111878 20:63414579-63414601 AGCGGGTGCTGGGGCTGAGGCGG + Intronic
1178312011 21:31537294-31537316 CAAGGGTCTTGGGACTGAAGAGG + Intronic
1178376725 21:32073644-32073666 TAAGAGTCCTGGTATTGAGGCGG - Intergenic
1179053747 21:37913500-37913522 TAAGGGTCCTAGGACTGAAGAGG - Intronic
1179139575 21:38712870-38712892 TAAAGCTCCTGGGGCTGGGAGGG + Intergenic
1179508791 21:41858740-41858762 TGAGGGTTCTGGGGAAGAGGGGG + Intronic
1179909059 21:44438442-44438464 GGAGTGTCATGGGGCTGAGGTGG + Intronic
1179968141 21:44818408-44818430 GCAGGGACCTGGGGCGGAGGAGG + Intronic
1180909898 22:19442499-19442521 TCAGGTTCCTGGGGCAGAGCTGG - Exonic
1181873985 22:25925565-25925587 TGATGGCCCAGGGGCTGAGGAGG + Intronic
1182127379 22:27825881-27825903 CACAGGTCCTGGGGATGAGGAGG + Intergenic
1182201914 22:28581292-28581314 TACGGGTACTGTGGCTGGGGAGG - Intronic
1183253726 22:36747364-36747386 TGAGGGTCCTGCGGCAGAGGAGG - Intergenic
1183378433 22:37478619-37478641 GAAGGGTTCTGGGGCTCAGGTGG + Intronic
1183697150 22:39429949-39429971 CAAGGGGCCTGGGGCAGAGTGGG - Intronic
1184336757 22:43858388-43858410 CAAGTGTCCTGGGTCTGCGGGGG - Intronic
1185103261 22:48852945-48852967 TAGGGGTCCTGGGGCTCAAGAGG + Intergenic
950423963 3:12914719-12914741 GACGGGTCCTGGGGGTGAGGAGG + Intronic
950551493 3:13668853-13668875 TGAGGGGCATTGGGCTGAGGTGG + Intergenic
950723003 3:14898127-14898149 TAAGGATGCAGGGGTTGAGGTGG + Intronic
951992564 3:28691938-28691960 AAAGGGTCCTGGGTCAGAGATGG - Intergenic
952891716 3:38046785-38046807 ACAGGATCCTGGGCCTGAGGGGG - Intronic
953192368 3:40699926-40699948 GAAGAGTCCTGGGGCTGTGCAGG - Intergenic
957069863 3:75559177-75559199 TAAGGGACCTAGGGCTGGGTAGG + Intergenic
958761717 3:98316918-98316940 TAAGGGACCTAGGGCTGTGCAGG - Intergenic
959538553 3:107514435-107514457 TAAATGTCTTGGGGTTGAGGGGG + Intergenic
960969664 3:123130487-123130509 TCAGGGACCTGGGGCTGTGGCGG - Exonic
961200623 3:125042753-125042775 CAAGGGTCCTCCGGATGAGGGGG + Intronic
961923091 3:130448336-130448358 TCAAAGTCCTGGGGCTGCGGAGG + Intronic
961959661 3:130841508-130841530 TATGTGTCATGGGGATGAGGAGG + Intergenic
962272363 3:133987188-133987210 TAAGAGTACTCTGGCTGAGGAGG - Intronic
962740010 3:138356744-138356766 TGAGGTTCCTGGGGCAGAGCTGG + Intronic
963036918 3:141038501-141038523 TAAGGGACCTGGTGCAGAGTAGG + Intergenic
965701165 3:171460322-171460344 TAAGGGCGCTGGGGCTGCGTGGG + Exonic
967854269 3:194104583-194104605 TATGAGTGTTGGGGCTGAGGAGG + Intergenic
968150847 3:196335583-196335605 CAAGGGTCCTGGGGCAGGGTGGG + Intronic
968803046 4:2755807-2755829 GCCGGGTCCTGGGGGTGAGGGGG - Intronic
968966990 4:3773756-3773778 TCTGGGACCTGGGGCTGGGGAGG - Intergenic
969571427 4:8010956-8010978 GAAGGGCCCTGGGGCTGAGTTGG + Intronic
973816733 4:54626242-54626264 TCAGGGACCTGCGGGTGAGGTGG + Intergenic
976614217 4:87059729-87059751 TAAGGGTCTGGGGGCTGCAGTGG - Intronic
977541765 4:98326643-98326665 AATGGGTGCTGGAGCTGAGGAGG - Intronic
977666126 4:99649411-99649433 TGTGGCTGCTGGGGCTGAGGAGG + Exonic
979402220 4:120262439-120262461 GAAGGGTAGTGGGGGTGAGGAGG + Intergenic
982804556 4:159748134-159748156 TAGGACTCCTGGGGCTGAGCTGG + Intergenic
983092829 4:163525190-163525212 TAAGGGTCCTGGGGCTGAGGTGG - Exonic
984884515 4:184438489-184438511 TACTGGTCCTGGGGTTGAAGGGG + Intronic
985603038 5:844685-844707 AAAGGGAACTCGGGCTGAGGAGG + Intronic
985929740 5:3047481-3047503 TCAGGGTCCTTGGGCTGTGGAGG - Intergenic
985942722 5:3151329-3151351 TAAGGCTGCTGGGGCTGCTGGGG - Intergenic
985992938 5:3578273-3578295 GAAGGGTGCAGGGGCCGAGGGGG - Intergenic
986463068 5:7993113-7993135 TAGGGGGGCTGAGGCTGAGGTGG + Intergenic
987699716 5:21381388-21381410 TAAGGGCAGTGGGGCTGACGTGG - Intergenic
991418952 5:66421248-66421270 TATGGGTTCTGAAGCTGAGGAGG + Intergenic
991711875 5:69415845-69415867 TAAGGGTCCGGGGCCTGAGCAGG + Intronic
991956579 5:72000760-72000782 GAAGGGTCCTGGGACAGAGCAGG - Intergenic
993081223 5:83302708-83302730 TTAGGGTTCTTGGGATGAGGAGG + Intronic
993872390 5:93267951-93267973 TCTGGGTGCTGTGGCTGAGGAGG - Intergenic
994503180 5:100606231-100606253 TAAGGGATCTGGGGCTGTGCAGG + Intergenic
997817266 5:137031236-137031258 TGAGGGACCTGGGTGTGAGGTGG - Intronic
998005924 5:138657028-138657050 TGTGGTCCCTGGGGCTGAGGTGG + Intronic
998214452 5:140226909-140226931 CAAGGGTCCTGGTGCTGCTGAGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
998461821 5:142315148-142315170 TAGGGGCCCTGGGGGTGGGGTGG + Exonic
999083752 5:148868665-148868687 TAAGGGTTCAGGTGGTGAGGAGG - Intergenic
999247051 5:150160622-150160644 CCACGGTCCTGGGGCTGAGAGGG - Intergenic
1001313996 5:170629939-170629961 TGATGGGGCTGGGGCTGAGGCGG + Intronic
1001746720 5:174098217-174098239 TCAGGGTGCTGGGGCTGGAGGGG + Intronic
1001759112 5:174192901-174192923 TAAGGGTCCTAAGGCTGCTGTGG + Intronic
1002204013 5:177550386-177550408 TAAAGGTCCTGGCACAGAGGTGG + Intronic
1002618229 5:180468603-180468625 TCAGGACCCTGGGGCTGAAGTGG - Intergenic
1003169470 6:3709765-3709787 CGAGGGTCCTGACGCTGAGGGGG - Intergenic
1005882583 6:30072242-30072264 TAGGGGTTGTGGGGCAGAGGAGG + Intronic
1006137061 6:31901797-31901819 TCAGGGTCGTGGGGCTGGGGGGG - Intronic
1006187400 6:32189219-32189241 AAGGGGTCCTGGGGCTGAGCAGG + Intronic
1006640744 6:35488404-35488426 TGTGGGTTCTGGGGCTGAAGGGG - Intronic
1007225153 6:40308593-40308615 CAGGGGTCCTGGGGCTGCGGTGG - Intergenic
1007401499 6:41605165-41605187 GAAGAGTTCTGGAGCTGAGGAGG + Intergenic
1007506134 6:42336890-42336912 TGAGGGCACTGGGGCTGCGGCGG + Intronic
1007763311 6:44146929-44146951 TAAGGGACTGGGGGCAGAGGAGG + Intronic
1008308286 6:49933550-49933572 AATGGGTGCTGAGGCTGAGGAGG - Intergenic
1013191368 6:107806722-107806744 CATGAGTCCTGGGGCTGGGGTGG - Intronic
1017535260 6:155340694-155340716 GGAGGGTACTGGGGCTGAGTGGG + Intergenic
1017541313 6:155405819-155405841 TGAGGGGCCTGGGACAGAGGTGG - Intronic
1017900604 6:158715791-158715813 TAAGTGTCCTGTGGCAGAGACGG - Intronic
1018232466 6:161688751-161688773 TGAAGGTCCATGGGCTGAGGTGG + Intronic
1018345252 6:162892869-162892891 CGAGGCTCCTGAGGCTGAGGTGG - Intronic
1018345263 6:162892909-162892931 CGAGGCTCCTGAGGCTGAGGTGG - Intronic
1018345285 6:162892995-162893017 CGAGGCTCCTGAGGCTGAGGTGG - Intronic
1019177370 6:170166963-170166985 TCAGGCTCCTGGGGCAGAGCTGG + Intergenic
1019340620 7:507247-507269 AAGGGGGCCTGGGTCTGAGGAGG + Intronic
1019378859 7:711272-711294 CACGTGTCCTGGGGCAGAGGCGG - Intronic
1019491915 7:1318211-1318233 CAGGGGTCCTGGGGGTCAGGGGG - Intergenic
1020139949 7:5606666-5606688 TGTGTGTCTTGGGGCTGAGGTGG + Intergenic
1021847865 7:24779994-24780016 TCAGGGTCTTGGGGCTGGGAAGG + Intergenic
1022098447 7:27155337-27155359 TTCGGGGCCTGGGGCAGAGGGGG - Intronic
1022132645 7:27418331-27418353 TTATGGTCCTGGGGATGGGGAGG + Intergenic
1022494345 7:30843809-30843831 AGTGGGTCCTGGGGCTGTGGGGG + Intronic
1022522886 7:31019349-31019371 TGTGGGTCCTGTGGCTGTGGTGG - Intergenic
1023096222 7:36662344-36662366 GAAGGGACCTGGGGCTAAGCAGG - Intronic
1023845279 7:44116837-44116859 TCTGGGTGCTGTGGCTGAGGAGG + Exonic
1023863874 7:44229651-44229673 TGGGGGTCCTGGGCCTGTGGTGG + Intronic
1023965406 7:44961261-44961283 TGAGGGTTGAGGGGCTGAGGGGG + Intergenic
1024053391 7:45644340-45644362 GACGGGTCCTGGGGCTGGGCAGG + Intronic
1026188687 7:68104549-68104571 TAAGGGACCTAGGGCTGTGCAGG - Intergenic
1026959037 7:74397059-74397081 TCAGGCTCCTGGGGGTGAGGCGG - Exonic
1027267040 7:76500201-76500223 CATGGCTCCTGGGGCTGAGCCGG + Intronic
1027318854 7:77000069-77000091 CATGGCTCCTGGGGCTGAGCCGG + Intergenic
1029061073 7:97798491-97798513 TTAGTGTCATGGGCCTGAGGAGG - Intergenic
1029177337 7:98674413-98674435 CAAGAGTCCTGAGGCTGAAGAGG + Intergenic
1029191471 7:98775177-98775199 TAAAGGTGCTGGGGGTGACGTGG - Intergenic
1029633411 7:101767771-101767793 GAAGGCTCCTGGGTCTGAGCGGG - Intergenic
1030068299 7:105677321-105677343 TAAGGAGACTGGGGCTCAGGGGG - Intronic
1030979564 7:116170605-116170627 GAAGGGTGTTGGGGGTGAGGAGG + Intergenic
1032161423 7:129513821-129513843 CAACGGTGCAGGGGCTGAGGAGG - Intergenic
1033582879 7:142752643-142752665 AAAAGGTGGTGGGGCTGAGGAGG + Intronic
1033598952 7:142875518-142875540 TATTGGTCCTGGGCTTGAGGGGG + Exonic
1034070551 7:148180632-148180654 TATAGGCCCTGGGTCTGAGGAGG - Intronic
1034578866 7:152025700-152025722 CGAGGGCCCTGGGCCTGAGGAGG + Intronic
1035376856 7:158412019-158412041 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035376865 7:158412048-158412070 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376890 7:158412137-158412159 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376907 7:158412196-158412218 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376915 7:158412226-158412248 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376923 7:158412256-158412278 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376940 7:158412315-158412337 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376965 7:158412404-158412426 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376973 7:158412434-158412456 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376982 7:158412463-158412485 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376990 7:158412493-158412515 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035376999 7:158412522-158412544 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377014 7:158412582-158412604 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035377040 7:158412671-158412693 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377049 7:158412700-158412722 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035377066 7:158412759-158412781 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377075 7:158412788-158412810 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035377083 7:158412818-158412840 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035377092 7:158412847-158412869 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377100 7:158412877-158412899 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377118 7:158412935-158412957 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377126 7:158412965-158412987 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035377135 7:158412994-158413016 GATGGGCCCTGGTGCTGAGGAGG - Intronic
1035377144 7:158413023-158413045 GATGGGCCCTGGAGCTGAGGAGG - Intronic
1035377159 7:158413082-158413104 GATGGGTCCTGGAGCTGAGGAGG - Intronic
1035377167 7:158413111-158413133 GATGGGTCCTGGAGCTGAGGAGG - Intronic
1036184777 8:6613615-6613637 CAAGGGACCGGGGGGTGAGGGGG + Intronic
1039226680 8:35396321-35396343 AAAGGCTCATGGGGCTGAGTCGG + Intronic
1039922026 8:41899900-41899922 TCAGGGTCCTGGGGCTGAAGAGG - Intergenic
1041392889 8:57362821-57362843 TAAGAGTGCTAGGGCTGTGGTGG + Intergenic
1042820049 8:72920528-72920550 TCAGGATACTGAGGCTGAGGTGG + Intronic
1044429253 8:92089565-92089587 TGAGGGGCTAGGGGCTGAGGTGG - Intronic
1047531999 8:125685365-125685387 TTAGGGGCCTGGGGAAGAGGTGG + Intergenic
1048176326 8:132155771-132155793 TAAGGGACCTTGGGCTCAGGTGG + Intronic
1049034316 8:140062453-140062475 TAAAGGCCCTGGGGCTGCGGAGG - Intronic
1049388203 8:142354849-142354871 CCAGGGTCTTGGGGCTGGGGAGG - Intronic
1049392371 8:142378844-142378866 CAAGGGTGCTGGGCCTGCGGTGG - Intronic
1049555519 8:143279452-143279474 TCGGGGTCCTGGGTCGGAGGAGG - Intergenic
1049876798 8:145028623-145028645 TAAGGGACCTAGGGCTGTGCAGG - Intergenic
1051636174 9:19182853-19182875 AGAGAGTCCTGGGGCAGAGGAGG - Intergenic
1056535534 9:87524353-87524375 TGAGGGCCCTGAGGGTGAGGGGG - Intronic
1057020468 9:91693443-91693465 TAAGGGCCCTGGAGGTAAGGAGG - Intronic
1059404372 9:114090996-114091018 TATGGGTCCTGGCGCTGGTGGGG - Intronic
1060550107 9:124481022-124481044 TCAGGGTCCCAGGGATGAGGTGG + Intergenic
1061011970 9:127961228-127961250 GAGGGGCCCCGGGGCTGAGGGGG - Intronic
1061178116 9:129009410-129009432 TGGGGCTCCTGGGGCTGGGGAGG - Intronic
1061659046 9:132116080-132116102 TATGGGAACAGGGGCTGAGGAGG - Intergenic
1062383982 9:136301402-136301424 GAAGGGTCCCGGGGCTGGGAGGG + Intronic
1062587044 9:137254122-137254144 TCTGGGTCCTGGGTCTGGGGAGG - Intergenic
1189485896 X:41431463-41431485 GAGGGGACCTGGGGCTGAGGTGG - Intergenic
1191812356 X:65203013-65203035 TCATGGTCCTGGGGCAGTGGTGG - Intergenic
1192156745 X:68752556-68752578 TATGAGCCCTGAGGCTGAGGGGG - Intergenic
1192689318 X:73345014-73345036 CAATTGTCATGGGGCTGAGGAGG + Intergenic
1192907945 X:75571605-75571627 GAAGGGTATGGGGGCTGAGGAGG - Intergenic
1195455082 X:105059263-105059285 GAAGGGTACTGGGGGTGGGGTGG - Intronic
1198967823 X:142245310-142245332 TATGGGTCCTGGGTCTGTGGGGG - Intergenic
1199948076 X:152683110-152683132 GCAGGGTCCTGTGCCTGAGGAGG + Intergenic
1199961603 X:152785344-152785366 GCAGGGTCCTGTGCCTGAGGAGG - Intergenic
1200259980 X:154609216-154609238 TAAGGGACCTAGGGCTGTGCAGG - Intergenic
1201060184 Y:10037676-10037698 TAAGGAACCTGGGTCTGAGGAGG + Intergenic