ID: 983095149

View in Genome Browser
Species Human (GRCh38)
Location 4:163552659-163552681
Sequence CCTCGTTGAATCCATCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983095146_983095149 -4 Left 983095146 4:163552640-163552662 CCCTATAGACACACTCAGGCCTC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 983095149 4:163552659-163552681 CCTCGTTGAATCCATCACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 84
983095147_983095149 -5 Left 983095147 4:163552641-163552663 CCTATAGACACACTCAGGCCTCG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 983095149 4:163552659-163552681 CCTCGTTGAATCCATCACTGAGG 0: 1
1: 0
2: 1
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983095149 Original CRISPR CCTCGTTGAATCCATCACTG AGG Intronic
903740268 1:25554603-25554625 CCTCTCTGAGTCCATCTCTGGGG + Intronic
904360290 1:29966761-29966783 GCTGGTGTAATCCATCACTGGGG + Intergenic
914924244 1:151870571-151870593 CCTCATTGTCTCCATCACAGAGG + Intergenic
920653339 1:207855004-207855026 CCTCTCTGAATCCATCATTATGG + Intergenic
921115619 1:212088087-212088109 TCCCATTGAATCAATCACTGGGG - Intronic
1066337770 10:34496601-34496623 CTTCGCTGAATCCATCCCTGTGG - Intronic
1067391032 10:45864428-45864450 CCCCGTTGAGCCCATCAGTGGGG - Intergenic
1067872248 10:49971677-49971699 CCCCGTTGAGCCCATCAGTGGGG + Intronic
1070138220 10:73714650-73714672 CCCCGTTGAGCCCATCAGTGGGG - Intergenic
1073748467 10:106496842-106496864 CCTTGTTGAAGCCATTACTTTGG - Intergenic
1075285185 10:121178592-121178614 CTTCGCTGATTCCATCCCTGAGG + Intergenic
1078055864 11:8008475-8008497 CCTCCTTGATTTCAGCACTGTGG - Intergenic
1081513305 11:43798973-43798995 ACTGGTTGAATCCATGAATGTGG + Intronic
1082709160 11:56532352-56532374 TCTGGTTTAATCCATCATTGAGG - Intergenic
1082896480 11:58195862-58195884 ATTGGTTGAATCCATGACTGTGG + Intergenic
1084569669 11:69951778-69951800 CCACTTTGGATCCACCACTGAGG - Intergenic
1085800578 11:79585613-79585635 CCTCCCTGAGCCCATCACTGTGG - Intergenic
1094042163 12:26129470-26129492 CCTCCTTAAATCCTTCTCTGAGG - Intronic
1095221555 12:39621933-39621955 CTTTGTTGCATCCACCACTGTGG - Intergenic
1096417485 12:51426111-51426133 CCTCGGGGAAACCATCCCTGAGG - Intronic
1096957220 12:55538871-55538893 CCTCCCTGACTCCATGACTGTGG + Intergenic
1102807226 12:115792751-115792773 CATCCCTCAATCCATCACTGGGG + Intergenic
1103139928 12:118539765-118539787 CATCCTTGAACCAATCACTGAGG + Intergenic
1104619769 12:130302236-130302258 CCTGGTTGAGTCCAGCACTCGGG - Intergenic
1105396697 13:20043428-20043450 CCACATTGCATCCACCACTGTGG - Intronic
1107350931 13:39514043-39514065 CTTCTTTGACTCCATCACTCAGG - Intronic
1107460506 13:40597532-40597554 CCTTGTTGAAGCCATGACTAAGG - Intronic
1118699463 14:68419049-68419071 CCTCACTGAATACAGCACTGGGG - Intronic
1118966735 14:70594377-70594399 TTTAGTTGAATGCATCACTGAGG + Intronic
1119315857 14:73694015-73694037 CCTCTTGGAAGGCATCACTGAGG + Intronic
1119679119 14:76578641-76578663 CACCCCTGAATCCATCACTGTGG + Intergenic
1122557404 14:102589005-102589027 CTTTGATGACTCCATCACTGGGG + Intergenic
1128052250 15:64674692-64674714 GCTTGTTTCATCCATCACTGAGG - Exonic
1128138786 15:65284141-65284163 CCTCCTTTAATCTATCAATGTGG + Intronic
1132406575 15:101544981-101545003 CCTCTTTGAACCTATCATTGTGG + Intergenic
1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG + Intronic
1137485099 16:48883974-48883996 CATCCCTGAATCAATCACTGGGG + Intergenic
1142752288 17:1996209-1996231 TCTCATTGAACCCATCTCTGAGG + Intronic
1144960958 17:19043687-19043709 CCTCCTGGAATCCATGGCTGTGG - Intronic
1144974202 17:19130837-19130859 CCTCCTGGAATCCATGGCTGTGG + Intronic
1152479583 17:80541431-80541453 CCTGGGTGATTCCATGACTGTGG - Intergenic
1153170628 18:2312017-2312039 CCTTCTTGACTCCATGACTGTGG - Intergenic
1153229871 18:2925304-2925326 GCTCGAAGAATCCATCACAGTGG - Exonic
1153725203 18:7947170-7947192 TCTCCTTGAATTCATCACTCAGG + Intronic
1155500714 18:26484465-26484487 TTTTGTAGAATCCATCACTGAGG + Intronic
1157112795 18:44836717-44836739 CCTCGGTAAGTTCATCACTGTGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1168310950 19:55460593-55460615 CGTCGTCGTTTCCATCACTGTGG - Intronic
925791356 2:7490331-7490353 CCTGGTTGAATCAATAAATGGGG + Intergenic
926054785 2:9768213-9768235 CCTCCTTGAATCCAACTCTGAGG + Intergenic
929574535 2:43043512-43043534 TCTCGGTGACTCCATTACTGAGG - Intergenic
931783311 2:65599180-65599202 CTTTGTTGAATCAATCACTGTGG + Intergenic
943768013 2:191683292-191683314 CCTCTTTTGATCGATCACTGTGG - Intronic
944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG + Intergenic
945922074 2:215764825-215764847 CATCTCTGAATCAATCACTGTGG - Intergenic
1169523811 20:6401429-6401451 CTTCGTTGCATCCCTCACTGAGG - Intergenic
1172547640 20:35773740-35773762 CCACTTTGAATCCAGCGCTGGGG - Intronic
1173259608 20:41422038-41422060 CTACGTTGAACCCATCACTGAGG - Exonic
1173973181 20:47168104-47168126 CATCCTTGAAGCAATCACTGTGG + Intronic
1176673799 21:9758382-9758404 GTTCCTTGAAGCCATCACTGGGG + Intergenic
1177633654 21:23758286-23758308 CCTCGGGGAACCCATCATTGTGG - Intergenic
950190986 3:10976030-10976052 CCTCCCTGAACCAATCACTGTGG + Intergenic
951548622 3:23854279-23854301 CCTCTCTGAACCAATCACTGTGG - Intronic
954157301 3:48693399-48693421 CCTCGTTGAGTACATCAGAGAGG - Intronic
955767932 3:62364458-62364480 CCTTGTTGATTCCATCATTGAGG - Intergenic
958095653 3:88940877-88940899 CCTCGTTGCACACATCACTAAGG + Intergenic
960543245 3:118883758-118883780 CCTCCATGAATCAATCACTGAGG + Intergenic
960872683 3:122265634-122265656 CATTCTTGAATCAATCACTGTGG + Intronic
961445221 3:126977357-126977379 CCCCCTTGAACCCATCACTGTGG - Intergenic
964538946 3:157757649-157757671 CTCCTTTGAGTCCATCACTGGGG + Intergenic
966656321 3:182362437-182362459 CCTCATTGAAACCAGCCCTGTGG + Intergenic
970520795 4:16881836-16881858 CCTAGTTGCAGCCATCACTGGGG + Intronic
980135148 4:128851642-128851664 CATCGATGCATCCATCTCTGAGG - Intronic
983095149 4:163552659-163552681 CCTCGTTGAATCCATCACTGAGG + Intronic
983274573 4:165601961-165601983 CCACCTTGAATCCACCCCTGTGG - Intergenic
986873296 5:12076669-12076691 ATTGGTTGAATCCATCAATGAGG + Intergenic
986973184 5:13361137-13361159 GCCTGTTGAATCCATCAGTGAGG - Intergenic
987805962 5:22769083-22769105 CCTCTTAGTAACCATCACTGGGG - Intronic
990102353 5:52207361-52207383 ACTCTTTCAATCAATCACTGAGG - Intergenic
990333900 5:54753688-54753710 CCTCTTTGATTCCAGAACTGAGG + Intergenic
995849746 5:116532587-116532609 CTTCGGTGACCCCATCACTGGGG + Intronic
999496020 5:152098277-152098299 CCTCCTTGCATCCATGATTGTGG + Intergenic
1001760989 5:174207920-174207942 TCATTTTGAATCCATCACTGTGG - Intronic
1004884516 6:20038633-20038655 CCTTGTTTAATCCACCACAGTGG + Intergenic
1008023121 6:46602717-46602739 CCTCTTTTAATTCAGCACTGTGG - Intronic
1008336021 6:50305872-50305894 CCTGGTAGAATGCATCACTTTGG - Intergenic
1024009826 7:45258276-45258298 CCTGGTTGAATGCATCACTGAGG - Intergenic
1025970087 7:66315188-66315210 CCTTGTTGATTCCCTTACTGTGG - Intronic
1041894806 8:62911759-62911781 CCTCTTTGAATTCATTACTTTGG - Intronic
1046648252 8:116809130-116809152 CCTCTTTGTCTCCATCACTTTGG + Intronic
1054934499 9:70672222-70672244 CATCCCTGAATTCATCACTGTGG - Intronic
1057170791 9:92961869-92961891 CCTTGCTGAATCACTCACTGTGG - Intronic
1186473552 X:9839435-9839457 CCTCCATGAAACTATCACTGTGG + Intronic
1188975211 X:36664725-36664747 CCTCATGGAATCCCTCTCTGAGG + Intergenic
1189204339 X:39225035-39225057 CCTCTCTGAACCAATCACTGAGG + Intergenic
1193960173 X:87915001-87915023 CTTCCTTGCATCCACCACTGTGG + Intergenic