ID: 983096738

View in Genome Browser
Species Human (GRCh38)
Location 4:163571309-163571331
Sequence ACCTCAGAGAATTTACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 2, 2: 3, 3: 35, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983096738_983096740 15 Left 983096738 4:163571309-163571331 CCAGAATGTAAATTCTCTGAGGT 0: 1
1: 2
2: 3
3: 35
4: 256
Right 983096740 4:163571347-163571369 TTGTCCACTACTAAAATCTTAGG 0: 1
1: 0
2: 0
3: 16
4: 117
983096738_983096739 -10 Left 983096738 4:163571309-163571331 CCAGAATGTAAATTCTCTGAGGT 0: 1
1: 2
2: 3
3: 35
4: 256
Right 983096739 4:163571322-163571344 TCTCTGAGGTCAGAAGATTCTGG No data
983096738_983096742 20 Left 983096738 4:163571309-163571331 CCAGAATGTAAATTCTCTGAGGT 0: 1
1: 2
2: 3
3: 35
4: 256
Right 983096742 4:163571352-163571374 CACTACTAAAATCTTAGGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983096738 Original CRISPR ACCTCAGAGAATTTACATTC TGG (reversed) Intronic
900804448 1:4758106-4758128 GCCTCAGGAAACTTACATTCAGG - Intronic
903844336 1:26268788-26268810 ACCTCAAAAAATTTGCAGTCTGG - Intronic
904312691 1:29639589-29639611 ACCTCAGAGAATATACATTCTGG + Intergenic
905326976 1:37160097-37160119 GCCTCAGGAAATTTACAATCAGG - Intergenic
905650572 1:39653864-39653886 TCCTCAGAGGATGAACATTCTGG + Intergenic
905743276 1:40390983-40391005 ACCTCAGACTATTGACATTTTGG + Intronic
906941591 1:50260396-50260418 CCCTCCGAGAGTTTGCATTCTGG + Intergenic
909575304 1:77169122-77169144 ACTTCAGAGAAGTTACATCAAGG + Intronic
910048229 1:82943521-82943543 ACCTAACAGAATTTACACTCTGG - Intergenic
910107843 1:83650928-83650950 ACCTCATGGAATGTGCATTCTGG + Intergenic
910648846 1:89542384-89542406 ACCTCATGGAATTTATAGTCTGG - Intronic
910860273 1:91736620-91736642 GCCTCAGAGAAGTTACACTTAGG - Intronic
911761220 1:101619534-101619556 AACTCACAAAATTCACATTCAGG + Intergenic
911822710 1:102440832-102440854 GCCTCAGCAAACTTACATTCAGG - Intergenic
912113855 1:106379358-106379380 AGCTCAGAGAATATACAGTAGGG - Intergenic
913615085 1:120550666-120550688 TCCTGAGAGAAGTTACATTCCGG + Intergenic
914575188 1:148960242-148960264 TCCTGAGAGAAGTTACATTCCGG - Intronic
915735626 1:158083077-158083099 CCCTCAGGGAACTTACAGTCTGG + Intronic
917015555 1:170527925-170527947 ACCTCACAAAATTCATATTCTGG - Intergenic
917775427 1:178329113-178329135 CCTTCAGGGAACTTACATTCTGG + Intronic
918809438 1:189096490-189096512 ACCTCAGAAAATTCAAATTGTGG + Intergenic
918835577 1:189460537-189460559 GTCTCATAGAATTTATATTCTGG - Intergenic
919012635 1:191984747-191984769 ATCTCAGAGATTTTGCATTTTGG + Intergenic
922018892 1:221683898-221683920 ACATCAGAGAATGTTCATACTGG - Intergenic
923514087 1:234680128-234680150 CCCTCAGGGAGCTTACATTCTGG + Intergenic
923836644 1:237618202-237618224 TCCTCAAAGAAATTACATTCTGG - Intronic
1066932766 10:41786069-41786091 AACTCAGCGAATGTACATTTGGG + Intergenic
1073079877 10:100852804-100852826 CCCTCATAGAGTCTACATTCTGG + Intergenic
1073546120 10:104350636-104350658 AGCTCAGAGAATCTAGATACTGG - Intergenic
1074597809 10:114883360-114883382 AGCTCAAAGAATTTACAATGTGG - Intronic
1077952726 11:6978439-6978461 AGCTCAGTGAATATACATTTAGG + Intronic
1077994723 11:7443277-7443299 CCCCCACAGAATTTACAATCTGG + Intronic
1079451945 11:20605460-20605482 ACCTCAGAGCATTTGCCATCGGG + Intronic
1079567572 11:21901424-21901446 GCCTTAGAGAATTTAAATTATGG + Intergenic
1080135382 11:28848163-28848185 ACCACAGAAAATTTTCATTGTGG + Intergenic
1080287920 11:30638153-30638175 ACCTCAGATATTTTGCATTAAGG - Intergenic
1080727106 11:34909319-34909341 ACCTAAAAGAATTCACACTCTGG + Intronic
1080728407 11:34920185-34920207 ACTTCAGAGAGTTTAAATTGTGG + Intronic
1080963491 11:37187260-37187282 GTCTCAGTGAATTTACCTTCAGG - Intergenic
1080981605 11:37413794-37413816 ACCTTAAAGATTTCACATTCTGG - Intergenic
1081028825 11:38051614-38051636 ACCTCAGAAAACTTACAATCAGG + Intergenic
1082983737 11:59147798-59147820 AACTCAGAGAATATACTTTCAGG - Intronic
1086105392 11:83141454-83141476 ACCTCACAGAATTTACATTCTGG + Intergenic
1086332364 11:85766705-85766727 GCCTCAGAGAGTTTAGATTCTGG + Intronic
1088299484 11:108341045-108341067 AACTTAGAGAATTGTCATTCAGG - Intronic
1089321061 11:117626987-117627009 GCCTGCGAGACTTTACATTCAGG + Intronic
1089333832 11:117709056-117709078 ACCTCATGGACTTTTCATTCTGG + Intronic
1089936503 11:122369876-122369898 CACTCAGGGAGTTTACATTCTGG + Intergenic
1090052990 11:123396690-123396712 ACCTCAGGGATTTTACTTTGTGG + Intergenic
1091658145 12:2360701-2360723 ACCTCAGAGACTGTCCAGTCCGG - Intronic
1092237671 12:6820229-6820251 ATCTCAGAGAATTTACGAGCAGG + Exonic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094075566 12:26469634-26469656 CTCTCAGGGAATTTGCATTCTGG - Intronic
1094243248 12:28253985-28254007 TCCTCAAAGAAGTTACAGTCTGG - Intronic
1095785607 12:46105799-46105821 TCCTCAAAGAGCTTACATTCTGG - Intergenic
1098098521 12:66987204-66987226 TCTTCACAGAACTTACATTCTGG - Intergenic
1098715352 12:73822751-73822773 ACCTCAGGAAATTTACAATCAGG + Intergenic
1099039898 12:77639477-77639499 TTCTCATACAATTTACATTCTGG - Intergenic
1099276843 12:80587075-80587097 GCCCCTGAAAATTTACATTCAGG - Intronic
1100006573 12:89901873-89901895 ACCCCAAGGAATTTACATTCTGG - Intergenic
1100362208 12:93889379-93889401 ACCTCAGAGGAATTACAGTGTGG - Intronic
1100715118 12:97297125-97297147 ACCTCAGAGACTTCTCATTCAGG - Intergenic
1105248704 13:18675624-18675646 ATCTCTGAGAATTTACATCCCGG + Intergenic
1106404068 13:29458437-29458459 AACCCAGAGAATTTATAATCAGG + Intronic
1107627245 13:42301768-42301790 ACCATAGAAACTTTACATTCTGG - Exonic
1108045381 13:46379056-46379078 CCCTCATAGATTTAACATTCTGG - Intronic
1108097096 13:46914106-46914128 ATCCCAGAAAATTTACCTTCAGG - Intergenic
1108240021 13:48454544-48454566 CCCTCATAGAGCTTACATTCTGG + Intronic
1109166597 13:59042857-59042879 ACCTTAAGGAACTTACATTCTGG + Intergenic
1109496087 13:63173994-63174016 ATCTCAGAGAATAGTCATTCAGG - Intergenic
1109522989 13:63536302-63536324 ACCCCATATAATTTACATGCTGG - Intergenic
1109683238 13:65781099-65781121 ACATCAGACAATTTATTTTCAGG - Intergenic
1109800030 13:67364501-67364523 ACTTCCAAGATTTTACATTCTGG - Intergenic
1112603520 13:100880430-100880452 AGCTCATGGAATTTACATGCTGG - Intergenic
1113367202 13:109687462-109687484 GTCACAGAGAATTTACATTCTGG + Intergenic
1117292273 14:54345136-54345158 TCCTCAAGAAATTTACATTCTGG - Intergenic
1117868957 14:60177640-60177662 CCCTCATGGAACTTACATTCTGG + Intergenic
1118714818 14:68551574-68551596 AGCTCACAGTATTTACATCCAGG + Intronic
1120314658 14:82875845-82875867 ACTGCAGAGAATTCACACTCAGG + Intergenic
1121560913 14:94874581-94874603 CCCTCACAGAACTGACATTCCGG - Intergenic
1121633501 14:95438438-95438460 CCCTCAGAGAATTTGGAATCCGG - Intronic
1121817005 14:96936236-96936258 CCCTCACAGAGTTTACAGTCCGG - Intergenic
1125188896 15:36966678-36966700 ACCTCATGGAATTTATATTCTGG + Intronic
1127133691 15:55896603-55896625 ACCTCAAGGAATTTACCGTCTGG - Intronic
1127827582 15:62718541-62718563 GCCTCAGAGAATCCAGATTCAGG - Intronic
1128377123 15:67085014-67085036 TCCTCAAAGAATATACTTTCCGG - Intronic
1131455171 15:92577997-92578019 ACCTCAGAGTAATTTCCTTCTGG - Intergenic
1133611993 16:7442155-7442177 ACCCCAGAGATTTTACCTTTTGG + Intronic
1138096214 16:54214053-54214075 GCCTCAAAAAACTTACATTCTGG + Intergenic
1138191599 16:55018159-55018181 AGCTCAGAGAAATTAGGTTCAGG + Intergenic
1138602835 16:58067211-58067233 ACCTCAGAGAATTTTAATTTGGG + Intergenic
1139770376 16:69270014-69270036 ACCTGATGGACTTTACATTCAGG - Intronic
1140464550 16:75169797-75169819 ACATCAGAGAATTCACACTGGGG + Exonic
1141272839 16:82556499-82556521 AGCTCAGAAAATTTGCATCCTGG - Intergenic
1141995109 16:87631917-87631939 ATCTCTGAGGATTTAAATTCTGG + Intronic
1142542536 17:671524-671546 AGCTGATAGAATTTGCATTCTGG - Intronic
1143286393 17:5792810-5792832 CTCTCAGGGAATTTATATTCAGG + Intronic
1143744058 17:8976934-8976956 ACCACAGAGAATTTGCATTAGGG - Intergenic
1143782218 17:9234864-9234886 ACTTCAGAGAATGGCCATTCTGG + Intronic
1147990276 17:44328475-44328497 GCTTCAAAGCATTTACATTCTGG - Intergenic
1149644041 17:58226655-58226677 ACCTCATGAAATTTACATTATGG + Intronic
1149856686 17:60088861-60088883 ATCCCAGAGAAATTACAGTCTGG + Intergenic
1153603464 18:6806331-6806353 ACCTCAGACAATTTACTTCAAGG - Intronic
1154440467 18:14385019-14385041 ATCTCTGAGAATTTACATCCCGG - Intergenic
1155672081 18:28383876-28383898 GCCTCTGAGAAGTTACAATCAGG - Intergenic
1156211987 18:34954289-34954311 GCCTAAGAGAATTTCCATTTGGG + Intergenic
1156506280 18:37596469-37596491 AACTCAGGGAATTTACTTGCGGG - Intergenic
1156582845 18:38397546-38397568 AACTCACAGACTTTTCATTCAGG + Intergenic
1158535577 18:58305386-58305408 ACCTCAGAAAATTAAATTTCTGG - Intronic
1158837427 18:61345824-61345846 ACCTCTCAGATCTTACATTCTGG - Intronic
1159248925 18:65848357-65848379 ACCTCAAGGAACTTACAATCTGG + Intronic
1160057747 18:75501051-75501073 ATCTCAGAGAATTAAAAATCTGG - Intergenic
1160735599 19:661044-661066 CCCTCACAGAATTTACAGGCTGG - Intronic
1161414582 19:4138639-4138661 CCCTCACAGAGTTTACAGTCTGG + Intergenic
1165646895 19:37447412-37447434 ACCTCCCAGAATTCACATCCTGG - Intronic
1165670018 19:37669138-37669160 ACATCAGAGAATTCACAGTGGGG - Exonic
927993275 2:27463337-27463359 CTCTCAGAGAACTTCCATTCTGG + Intronic
928810127 2:35213875-35213897 ACCTCAGGGAGTGTATATTCTGG + Intergenic
929287243 2:40149315-40149337 ATCTCATAGAATTTCCATTCTGG + Intronic
929885211 2:45872042-45872064 CCCTCATGGAACTTACATTCTGG + Intronic
930512342 2:52360267-52360289 GCCTCAGAAAACTTACAATCTGG - Intergenic
930652650 2:53977809-53977831 ACCTCACATACTTAACATTCTGG + Intronic
930804399 2:55475786-55475808 ACATCATAGAAATTACATGCTGG + Intergenic
931269811 2:60691578-60691600 ACCTGCCACAATTTACATTCTGG - Intergenic
931391845 2:61851205-61851227 TCCTCACAGAATTTTCAGTCTGG - Intronic
932866241 2:75346004-75346026 ACCTCAGAGAATATACCGTCTGG - Intergenic
937686628 2:124705189-124705211 CCCTCATGGAATTTACATTATGG - Intronic
939014218 2:136883187-136883209 TCCTCAAAGAATTTTCATTTTGG + Intronic
939103078 2:137917945-137917967 ATCTCTGAGAATTTACATCCTGG + Intergenic
939524007 2:143269590-143269612 AACTCAGAGATTTAAAATTCAGG - Intronic
940695932 2:156978536-156978558 AACTCAGAGAATTCACAGACAGG - Intergenic
941137460 2:161735021-161735043 GCCTCAGAAAACTTACAATCAGG - Intronic
941489937 2:166131026-166131048 TCCACAGGGAGTTTACATTCTGG - Intergenic
941617820 2:167741401-167741423 CCCTCAGAGAAGTTACAGTCTGG + Intergenic
942210169 2:173662234-173662256 GCCATATAGAATTTACATTCTGG + Intergenic
942408841 2:175685222-175685244 AACTAAAAGAATTTACAGTCTGG - Intergenic
946533424 2:220600035-220600057 CCCTCAGAGTATTTACATCATGG - Intergenic
946631935 2:221678703-221678725 ACCTCAGAAAACATACAATCAGG - Intergenic
946650170 2:221884928-221884950 ACCTCATGGAACTTATATTCTGG + Intergenic
947421979 2:229949296-229949318 ACCTCAGGGAATTTACCCTAAGG + Intronic
948830680 2:240596984-240597006 CCCTCAGAGAATTTGCATCTTGG + Intronic
1169769708 20:9187497-9187519 CCCTCAGAGGGTTTACAGTCTGG - Intronic
1170618525 20:17974542-17974564 ACCTCAGAAAATGAACATACAGG + Intronic
1172120952 20:32598455-32598477 ACCTCATAGAATTCACAGCCAGG - Intronic
1172591882 20:36123411-36123433 TCCTCAGAAAATTTAAGTTCTGG + Intronic
1173186897 20:40847219-40847241 ACCTCATAGAGTGTTCATTCTGG - Intergenic
1175005584 20:55678837-55678859 ATCTCACAGGACTTACATTCTGG + Intergenic
1176455574 21:6906146-6906168 ATCTCTGTGAATTTACATCCCGG + Intergenic
1176833746 21:13771194-13771216 ATCTCTGTGAATTTACATCCCGG + Intergenic
1176894052 21:14354520-14354542 CCCTTAGAGAATCTACATTTGGG + Intergenic
1177165171 21:17593758-17593780 ACCTTTGAGAATTTACTTTATGG - Exonic
1177445060 21:21184000-21184022 ACCTAAGATAATAAACATTCTGG - Intronic
1178125338 21:29509893-29509915 TCTTCAAGGAATTTACATTCTGG - Intronic
1178286442 21:31329202-31329224 CCCTCAGGGAACTGACATTCTGG - Intronic
1178553726 21:33567516-33567538 TCCTCACAGAGTTTACAATCTGG + Intronic
1181153633 22:20903121-20903143 GCATCAGAAAACTTACATTCTGG - Intergenic
1181287522 22:21764889-21764911 ACCTGAGAAAATTCACAATCAGG + Intronic
1185121875 22:48976328-48976350 CCCTCTGAGAATTCACATTCAGG + Intergenic
949320787 3:2808308-2808330 TCTTCAGAGAATATTCATTCTGG + Intronic
950056409 3:10028219-10028241 TCCTCAGGGAATTTACAGTATGG - Intronic
951121997 3:18940169-18940191 GCCTCAGAAAACTTACAATCTGG - Intergenic
951126562 3:18991620-18991642 ACCTCATGGAGTTTACAATCTGG - Intergenic
952145223 3:30525152-30525174 ACCACAGAAAATTTACATCCAGG - Intergenic
952282977 3:31940983-31941005 TGCTCAGGGAATTCACATTCTGG - Intronic
953440745 3:42914784-42914806 ACATCAGAGAATTCACAGTGGGG + Exonic
953642443 3:44721753-44721775 ACATCAGAGAATTCACACTGGGG + Exonic
953722277 3:45366858-45366880 CCCTCAAAGAACTTACAGTCTGG + Intergenic
953992252 3:47493136-47493158 AGCTCATAGAACTTACGTTCTGG - Intergenic
955765278 3:62337867-62337889 TCCTCATAGAATTTACATTCTGG + Intergenic
956080761 3:65553290-65553312 ACCACAGAGAATATAAGTTCTGG - Intronic
958622988 3:96585541-96585563 CCCTCAGTGAACTTACATTCTGG - Intergenic
959532200 3:107446417-107446439 AATTCAGAGAATTTAAATTATGG + Intergenic
963566159 3:146933587-146933609 GCCTCACTGAATTTACATACTGG - Intergenic
964595325 3:158420874-158420896 CCCTCATGGAATGTACATTCTGG + Intronic
964682430 3:159357228-159357250 ACCTAAGAGAATCTAAGTTCAGG + Intronic
965532398 3:169786039-169786061 CTCTCAAAGAATTTACAGTCTGG + Intronic
966585107 3:181615052-181615074 ACCTTACAGAGTTTACAGTCTGG + Intergenic
967329261 3:188274367-188274389 ACCTCAAGGAATTTACAGTCTGG - Intronic
967642413 3:191881676-191881698 ACCTCAGAGAACTTAGATTCCGG + Intergenic
967699931 3:192580036-192580058 ACCTCAAATAACTTACAATCTGG + Intronic
972429359 4:38965440-38965462 CCTACAGAGAATTTACACTCTGG - Intergenic
973301962 4:48595203-48595225 AGCTCAGAGAATTTATAGTAGGG - Intronic
973938455 4:55877117-55877139 ACTTAAAAGAATTTAAATTCAGG + Intronic
975020136 4:69475785-69475807 ACATCACAGAATTTTCATTTAGG + Intergenic
977422436 4:96819001-96819023 GCCTCAGGGAACTTACAATCAGG - Intergenic
977651624 4:99476525-99476547 CTCTCATAGAACTTACATTCTGG - Intergenic
979113408 4:116788773-116788795 ACCACAGGGAATTTTCATTTTGG + Intergenic
981842142 4:149124835-149124857 TACTCAGAAAATTTGCATTCAGG + Intergenic
982438131 4:155401112-155401134 CCCTTAGAGAATTTATATTGTGG - Intergenic
983096738 4:163571309-163571331 ACCTCAGAGAATTTACATTCTGG - Intronic
983577568 4:169274982-169275004 ACTTCAGGGAACTTATATTCAGG - Intergenic
983702449 4:170614658-170614680 ACCTAAGAGAATCTCCATTAGGG - Intergenic
984514400 4:180720327-180720349 TCCTTAGGGAATTTACCTTCTGG + Intergenic
984552512 4:181177570-181177592 ACATCAGAGAATTCACTATCTGG - Intergenic
989118415 5:37979010-37979032 CCCTCAGGAAACTTACATTCTGG + Intergenic
990194944 5:53304103-53304125 CCCTCAAAGAATTCCCATTCAGG + Intergenic
990852888 5:60227376-60227398 ACCTCATGGAACTTACATTCTGG - Intronic
992667750 5:79027662-79027684 ATCTCAGTGAACTTACAGTCTGG + Intronic
992733789 5:79698768-79698790 CCCTCATGGAATTTACATTCTGG - Intronic
992769274 5:80032292-80032314 GCCTAACAGAATTTACAATCTGG - Intronic
992985024 5:82219933-82219955 CCCTCAAAGAACTTATATTCTGG + Intronic
994146190 5:96398188-96398210 ACCTCTAAGAATTAATATTCAGG + Intronic
994379297 5:99052625-99052647 ATCTCATAGAATTTAAAGTCTGG - Intergenic
994597431 5:101858038-101858060 GCCTCAGGAAATTTACAATCAGG + Intergenic
995000117 5:107117642-107117664 ACTTTACAAAATTTACATTCTGG + Intergenic
995349616 5:111159998-111160020 GCCTCAGAAAATTTACATCAGGG + Intergenic
996227057 5:121012595-121012617 ACCTGAGACATTTTACTTTCTGG - Intergenic
997382191 5:133445887-133445909 AACACAGATAATTTACATACAGG + Intronic
997764621 5:136488193-136488215 ACCTTATGGAATTTGCATTCTGG - Intergenic
998189963 5:140015238-140015260 CCCTCATGGAATTTACTTTCTGG - Intronic
998629414 5:143881802-143881824 TCCTCTGAGAATTTGGATTCTGG - Intergenic
1002767993 6:259488-259510 ACAAAATAGAATTTACATTCTGG + Intergenic
1003327420 6:5102914-5102936 ACCTCTGAGAGTTTTCCTTCTGG + Intronic
1003346691 6:5275466-5275488 CCCTCACAGAATTCACATTCTGG - Intronic
1005055812 6:21727958-21727980 ACCTCAGAGAAGTTTCCATCTGG - Intergenic
1005679196 6:28188817-28188839 ACGTCAGAGAATTCACACTGGGG + Intergenic
1005688285 6:28276724-28276746 ACATCAGAGAATTCACAGTCAGG + Exonic
1005731200 6:28698525-28698547 ACCTCAGGGGATTTAGATCCAGG + Intergenic
1005832202 6:29680248-29680270 CCCTCAGAGGATTTACATTCTGG - Intronic
1007156968 6:39754283-39754305 ACTTCAAAAAATTTACAATCTGG - Intergenic
1007364009 6:41377438-41377460 ACCACAGAGAATGTACTTTCGGG - Intergenic
1007932512 6:45705212-45705234 CCTTCAAAGAATTTATATTCTGG + Intergenic
1011016739 6:82764650-82764672 CCCTCAGAGAACTCATATTCTGG - Intergenic
1011631620 6:89331613-89331635 CCCTCACAGAACTTACATTCTGG + Intronic
1013825069 6:114201800-114201822 ACCTCAGGAAACTTACAATCAGG + Intronic
1014419859 6:121230007-121230029 GCCTCAGGAAACTTACATTCAGG - Intronic
1014528854 6:122535199-122535221 TCTTCAGAGACTTTACATTTTGG + Intronic
1016381023 6:143480140-143480162 ACTTCAGAGAATATACTTTATGG - Intronic
1016673062 6:146731021-146731043 GCCTTAGAGCATTTACATTTAGG - Intronic
1016768053 6:147817169-147817191 CCCTCAGGGAATTTACATCATGG - Intergenic
1016980993 6:149853986-149854008 ATTCCAGAGAATTTACATGCAGG - Intronic
1019210875 6:170403741-170403763 ACCACAGAGAAGTGACAATCTGG - Intronic
1021183417 7:17534709-17534731 ACCTCACAGATTTTAGATTTTGG + Intergenic
1021238941 7:18177246-18177268 ACTTCACAGAATTTAAATGCAGG - Intronic
1021873460 7:25026698-25026720 ACCTCAAAGAGCTTATATTCTGG - Intergenic
1022158939 7:27689643-27689665 ACCTCAGGGACTGTACAGTCAGG + Intergenic
1022855731 7:34311545-34311567 ACCTCAGAAAACTTACAATCAGG - Intergenic
1025632668 7:63289833-63289855 ACATTAGAGAATTTATATTGGGG - Intergenic
1028092485 7:86720882-86720904 GCCTCTGAGAGTTTACATTGAGG + Intronic
1028242538 7:88438709-88438731 CCCTCAGGGAGTCTACATTCTGG - Intergenic
1028410865 7:90529125-90529147 ACCTCAGGGAATTTAAATCACGG - Intronic
1028542820 7:91962613-91962635 CCCTCAGTGAACTTACCTTCCGG + Intronic
1030069305 7:105685213-105685235 ACCTCAGAGCATAGACATTCTGG - Intronic
1030326633 7:108226580-108226602 ACCCCAGAGAAGTTACTGTCAGG - Intronic
1030585062 7:111407514-111407536 ACCTCAGAAACATTACACTCAGG + Intronic
1032877973 7:136058055-136058077 CCCTGAGAGAATTTATAGTCTGG + Intergenic
1032932195 7:136686068-136686090 AACCCAGATAATTTAGATTCTGG - Intergenic
1032973360 7:137191943-137191965 ACCTATGAGCATTTACATACAGG + Intergenic
1033761861 7:144444355-144444377 CCCTCACAGAACTTACATTATGG - Intergenic
1034543097 7:151772032-151772054 TCCTCAGACAGTTTACACTCTGG + Intronic
1034584906 7:152081405-152081427 AGCTCACCCAATTTACATTCCGG - Intronic
1037482757 8:19320125-19320147 ACCTCAGAGATTTTTCTTTGAGG + Intronic
1038632414 8:29258563-29258585 TCCTCACAGAATCTCCATTCTGG + Intronic
1038922691 8:32102501-32102523 TCCTCAAGGAATTTACAGTCTGG + Intronic
1040946018 8:52884778-52884800 ACCTCAGGAAACTTACAATCAGG + Intergenic
1042449886 8:68932140-68932162 TCCTCAAAGAACTTCCATTCTGG + Intergenic
1043458451 8:80435810-80435832 ACTTCAAAGGATTTACAATCCGG - Intergenic
1043857487 8:85278366-85278388 AACTCAAAGTATTTTCATTCAGG + Intronic
1043965201 8:86466344-86466366 TCTTCATGGAATTTACATTCTGG - Intronic
1044305742 8:90638556-90638578 TCCTCACAGAATTTATAGTCTGG - Intronic
1044489353 8:92793659-92793681 GCCTCAGAGAGTTGACAGTCTGG + Intergenic
1045099467 8:98829811-98829833 CCTTCAGGGGATTTACATTCTGG + Intronic
1048940862 8:139399517-139399539 CCTTCATAGAACTTACATTCTGG + Intergenic
1049871009 8:144976370-144976392 ACATCAGAGAATTCACAGTGGGG - Intergenic
1050139598 9:2503490-2503512 ACCAAAAAGAATGTACATTCTGG + Intergenic
1051361112 9:16282594-16282616 ACCACAAAGAATAAACATTCAGG + Intergenic
1051932138 9:22399028-22399050 ACTTCAGCAAAATTACATTCAGG - Intergenic
1054756369 9:68962634-68962656 AACTCAGAGAATTAAAATTATGG + Intronic
1055665412 9:78548000-78548022 ACCACAGAGACTTTATATTGGGG - Intergenic
1056135302 9:83624451-83624473 CCCTCAAAGGATTTACATTCTGG + Intronic
1056220516 9:84446884-84446906 TCCTCAGAGACATTGCATTCAGG + Intergenic
1057714016 9:97474382-97474404 ACCTCAGGGCATTCATATTCAGG + Intronic
1058145673 9:101408347-101408369 ACATCAGAGAATTCACACTGGGG + Exonic
1058753890 9:108066209-108066231 CCCACATACAATTTACATTCCGG - Intergenic
1059038522 9:110787034-110787056 ACGTCATGGAATTTAGATTCTGG + Intronic
1059635147 9:116163142-116163164 CCCTCAGGGAGTTTATATTCTGG + Intronic
1203624526 Un_KI270750v1:106-128 ACCTCAGAAAACTTACAATCAGG - Intergenic
1185957856 X:4511799-4511821 ACCTCAAAGAATTTTCCATCTGG + Intergenic
1186695559 X:12027558-12027580 ACCTCAGCAAATTTATTTTCAGG - Intergenic
1188282850 X:28291495-28291517 ACATAAGAGAATCTAAATTCTGG + Intergenic
1188394169 X:29659977-29659999 GCCTCAGGGAATTCACAATCAGG + Intronic
1189445726 X:41078967-41078989 AACTCAGAGTATTTTCATTTTGG + Intergenic
1189550500 X:42087595-42087617 CCCTCATAGAATTTATAGTCTGG - Intergenic
1189745479 X:44164182-44164204 CGCTCAAAGAATTTACATTCTGG - Intronic
1189977309 X:46475052-46475074 ATATCAGAGCACTTACATTCAGG + Intronic
1190249501 X:48711497-48711519 AACTCAGAGACTTCACAATCAGG + Intergenic
1190250435 X:48719967-48719989 AGCTCAGAGAACTCACATCCTGG + Intergenic
1190251479 X:48730068-48730090 AGCTCAGATAATTCAAATTCTGG + Intergenic
1190701742 X:52994463-52994485 AAATCAGAGAACCTACATTCTGG + Intronic
1190701762 X:52994597-52994619 AGCTCAGAGACTTCACATCCTGG + Intronic
1191097863 X:56693151-56693173 CCCTCATGGAGTTTACATTCTGG + Intergenic
1196583475 X:117402460-117402482 ACCTAATAGAAGTTACAATCAGG + Intergenic
1197514900 X:127414774-127414796 ACCTCACTGAATATACATGCAGG - Intergenic
1198124489 X:133629085-133629107 ACCTATGAGAAATCACATTCTGG + Intronic
1198178510 X:134180994-134181016 CCATCACAGAATTTACAATCTGG - Intergenic
1199192523 X:144987334-144987356 GCCTCAGGGAGTTTACAGTCTGG + Intergenic
1201267558 Y:12222816-12222838 AGCTCAGAGAATCCAAATTCAGG - Intergenic