ID: 983098352

View in Genome Browser
Species Human (GRCh38)
Location 4:163593348-163593370
Sequence CTGCATACATTGAAGTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983098352 Original CRISPR CTGCATACATTGAAGTAAAA AGG Intronic
906275875 1:44515150-44515172 CTTCAAACATTGAGGCAAAATGG - Intronic
907203930 1:52752374-52752396 CTGCACACATTGAAGTGCTAGGG - Intronic
908822050 1:68098433-68098455 CTACATACATTGAGTTAATATGG + Intergenic
908871913 1:68622925-68622947 CTGAAATCTTTGAAGTAAAAGGG + Intergenic
909789622 1:79659530-79659552 ATGCATACATGGAAGAAAACAGG - Intergenic
910978646 1:92936256-92936278 CTGCATTCATTTAACTAAATAGG + Intronic
913294141 1:117302420-117302442 CTGCATTAATTGTAGTGAAAGGG + Intergenic
917898269 1:179514928-179514950 CTACATAAACTGAAATAAAAAGG - Intronic
918401904 1:184172090-184172112 CTGCATCCATTAAATTAAAAAGG - Intergenic
919565975 1:199188818-199188840 CTGCATAAATTGATGTGAGAGGG - Intergenic
920580440 1:207102045-207102067 TTGCAAACAATGAAGTAATAAGG + Intergenic
922872517 1:228914854-228914876 ATGAGTACATTGAAGTTAAAAGG + Intergenic
924271266 1:242334967-242334989 TTGCATACATAGAAGAAATAGGG - Intronic
924271331 1:242336002-242336024 CTGCATACATAGGAGAAATATGG - Intronic
1066308209 10:34168308-34168330 CTGCGTACTTTGATTTAAAATGG + Intronic
1066706593 10:38186258-38186280 TTGTATTCATTGCAGTAAAATGG + Intergenic
1066713406 10:38261156-38261178 TTGCATACATAGAAGAAATAGGG + Intergenic
1066982703 10:42433738-42433760 TTGTATTCATTGCAGTAAAATGG - Intergenic
1067157964 10:43798735-43798757 CTGCATATATTAAAGACAAAAGG - Intergenic
1069434145 10:68365603-68365625 ATGCATACATTTAAGAAAGATGG - Intronic
1073824539 10:107305100-107305122 CTGCATACATTGAAATGCATAGG + Intergenic
1074402884 10:113156532-113156554 TGGCATACATTGAAATGAAATGG - Intronic
1074700710 10:116089652-116089674 CTGCATACATTTCAGAAAATGGG + Intronic
1075526709 10:123193216-123193238 ATGAATACATTGAATTAGAAAGG - Intergenic
1077995244 11:7446997-7447019 CTGCAAATAGTGAAGCAAAAGGG - Intronic
1079656447 11:22991856-22991878 CTGCATACATGGAGGCAAAGTGG + Intergenic
1081103822 11:39039200-39039222 CTGAATGGATTGAAGTAAATGGG + Intergenic
1081108566 11:39103102-39103124 CTATATATATTGAAGCAAAAAGG + Intergenic
1084187185 11:67480114-67480136 CTGCATACAATTAAGTATGATGG - Intergenic
1086092265 11:83016813-83016835 TTGCTTACATTGAAGTGAGAAGG - Intronic
1086581476 11:88404562-88404584 CTGGATAGAAAGAAGTAAAAAGG + Intergenic
1086581601 11:88406103-88406125 CTGGATAGAAAGAAGTAAAAAGG + Intergenic
1087364878 11:97205848-97205870 CTGGATAGAATGAAGTAGAATGG - Intergenic
1087511268 11:99097843-99097865 CTGTATAAATTGAAGGTAAAAGG + Intronic
1089045280 11:115496767-115496789 CTGCTTGCACTGAAATAAAATGG - Intronic
1089645846 11:119878236-119878258 GTACATACTTTGAAGAAAAATGG + Intergenic
1091326034 11:134688648-134688670 CTGTATACCTTGGAGCAAAATGG + Intergenic
1094416662 12:30223479-30223501 CTGCAAGCATTGAATTAAGATGG - Intergenic
1095443615 12:42262586-42262608 CTGCAATCATAAAAGTAAAAAGG - Intronic
1095581767 12:43808110-43808132 CTGCATACATTGTTTTCAAATGG - Intergenic
1098026784 12:66212374-66212396 CTGCAGCCAATGAAGCAAAAAGG + Intronic
1098865924 12:75763530-75763552 CTACATACATTTATCTAAAAGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1104174779 12:126319895-126319917 GTGCATACCATTAAGTAAAAAGG - Intergenic
1105792487 13:23816103-23816125 CTGGATACATTGTTGTCAAACGG - Intronic
1105928471 13:25030481-25030503 CTTCTTACATTTAATTAAAATGG - Intergenic
1105942420 13:25160599-25160621 CTTCTTACATTTAATTAAAATGG + Intergenic
1106631961 13:31483569-31483591 CTGCAGAGATAGAAGTAGAAGGG + Intergenic
1107072877 13:36290949-36290971 CTGCATACCTTGACCAAAAAAGG + Intronic
1107140667 13:36995426-36995448 CTTCATACAATGAAGAAAAACGG - Exonic
1108300827 13:49074009-49074031 TTGCAGACAATGTAGTAAAAGGG + Intronic
1108997637 13:56754551-56754573 ATTCATTCATTGCAGTAAAAGGG - Intergenic
1111529130 13:89513808-89513830 ATGGATACAATGAAGGAAAATGG + Intergenic
1113424477 13:110196640-110196662 CTGCATAAAATGAATTTAAATGG - Intronic
1114380820 14:22201631-22201653 TGGCATACATTGAAGGAGAAAGG - Intergenic
1115057821 14:29152209-29152231 CTGCATTTAGTGAAATAAAAGGG - Intergenic
1115075628 14:29386420-29386442 CTGCATACATAGATATAAAGGGG - Intergenic
1116438457 14:44921989-44922011 CTGCATGCATTAGAATAAAAAGG + Intergenic
1117489878 14:56235853-56235875 CTGCGTACATTTAGGTACAAAGG + Intronic
1118960451 14:70525185-70525207 ATACATACATTAAAATAAAATGG - Intronic
1118996679 14:70842754-70842776 ATGCATACATAGAAGTGCAAAGG + Intergenic
1127729995 15:61791050-61791072 CTGCATACTTTGAAGGATATTGG - Intergenic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1129690262 15:77709352-77709374 CTGCATACAGTGAGGTCAAATGG - Intronic
1131262781 15:90896806-90896828 ATGAAAACCTTGAAGTAAAATGG + Intergenic
1131383881 15:91986468-91986490 CTGCATACTTTAAAAAAAAATGG - Intronic
1143881529 17:10033786-10033808 CTGCAGGCACTGAAGGAAAATGG + Intronic
1147493585 17:40894830-40894852 GTGCACACACTTAAGTAAAAAGG + Intergenic
1149158040 17:53657255-53657277 CTACATTCATTAAAGAAAAAAGG + Intergenic
1149376241 17:56047030-56047052 CTGGATAGATTGAAGTTGAAAGG + Intergenic
1150326786 17:64263750-64263772 CTGCAGACATTGATTTAAAAAGG + Intergenic
1153666781 18:7373464-7373486 TTGCATATTTTGAAATAAAATGG - Intergenic
1154989704 18:21589288-21589310 GTGGCTACATTGAAGTAATAGGG - Intronic
1156887467 18:42152066-42152088 CTGCTTGCAACGAAGTAAAATGG - Intergenic
1158803694 18:60944647-60944669 GTGTATACGTTGGAGTAAAAGGG + Intergenic
1160293285 18:77615064-77615086 CTTCACACAGTGAAGTAATAGGG + Intergenic
1162152611 19:8656587-8656609 CTGCACCCGTAGAAGTAAAAAGG - Intergenic
1163947338 19:20551008-20551030 CTGCCTACATTGCTGTAAATGGG - Intronic
1163971080 19:20795779-20795801 CTGCCTACATTGTTGTAAATGGG + Intronic
1168700420 19:58435648-58435670 CTGCAGACAGGGATGTAAAATGG + Intronic
929501017 2:42492247-42492269 CTCCATACTTTGTAGGAAAAGGG + Intronic
930155300 2:48100954-48100976 CTACATACATTGAAGAACACAGG - Intergenic
930282695 2:49389696-49389718 CTGCATATATTGAGGTAATCAGG - Intergenic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
931322808 2:61188317-61188339 CTGCAGAGATAGAAGTAGAAGGG + Exonic
933245691 2:79972233-79972255 CTGCATAAATGGTAATAAAATGG - Intronic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
936069591 2:109356748-109356770 CTGCCCACATTGCAGTAACATGG + Intronic
936257789 2:110931907-110931929 GTAAATACATTGAAGTGAAATGG - Intronic
936581912 2:113707898-113707920 CAGGATACATTGTAGTATAAAGG - Intronic
936658830 2:114519431-114519453 TTGCATACATTGATCTAAAAAGG + Intronic
939370540 2:141293704-141293726 CAGAATACATTTAAGTAAAAAGG + Intronic
940065141 2:149619271-149619293 CTTCATGTATTGAAGTAAATTGG - Intergenic
940171518 2:150834176-150834198 CTGCATAAATTTCAGTAATATGG + Intergenic
940435127 2:153643829-153643851 CTGCATAGATTGAAATGATATGG - Intergenic
943497535 2:188641607-188641629 CAGAATACATAGAAATAAAATGG + Intergenic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
943874700 2:193050271-193050293 CAGAATCCATTAAAGTAAAATGG - Intergenic
944394943 2:199255911-199255933 TTGCATACATTGAAGTATCCTGG + Intergenic
945585673 2:211659063-211659085 CATCATACAATGATGTAAAAAGG + Intronic
946262208 2:218503413-218503435 TAACATACATAGAAGTAAAATGG + Intronic
946534179 2:220608237-220608259 CTGCAGAAATTTAAGTAACAAGG - Intergenic
946964730 2:225025760-225025782 TTGCAAATATTGTAGTAAAAGGG - Intronic
1169271213 20:4200739-4200761 CTGCCTACATTGAAGAACACAGG - Intergenic
1172843938 20:37918595-37918617 CTGAATTTATTTAAGTAAAAGGG + Intronic
1172922486 20:38496968-38496990 CTGCTCACATTGAAGCAGAATGG - Intronic
1173393744 20:42658827-42658849 TTGCATTTATTGAAGTAAAAAGG + Intronic
1175614114 20:60378052-60378074 CTGCATTCATAGAAGAAAGAGGG - Intergenic
1176328345 21:5522112-5522134 ATGCATACATTGAACAAAATTGG + Intergenic
1176399412 21:6298839-6298861 ATGCATACATTGAACAAAATTGG - Intergenic
1176437745 21:6690265-6690287 ATGCATACATTGAACAAAATTGG + Intergenic
1176462007 21:7017335-7017357 ATGCATACATTGAACAAAATTGG + Intergenic
1176485568 21:7399113-7399135 ATGCATACATTGAACAAAATTGG + Intergenic
1177016377 21:15794176-15794198 CTATATACTTTGAAGTTAAAGGG - Intronic
1178191439 21:30286088-30286110 CTGCATATATAGTAGCAAAAGGG - Intergenic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1181575963 22:23795059-23795081 GTCCATACCTTGAAGTACAAGGG + Intronic
949322956 3:2832136-2832158 CTGTGTCCATTGAAGTAAACTGG - Intronic
950996212 3:17499796-17499818 AAACAAACATTGAAGTAAAATGG - Intronic
951534354 3:23727889-23727911 CTGCCTACATTAAACAAAAAGGG - Intergenic
951565229 3:24006318-24006340 CAGAATACATTTAGGTAAAATGG - Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
955702899 3:61699760-61699782 CTGAATTCATTGGAGTAAAAGGG + Intronic
956260291 3:67331865-67331887 CTGCATTCTTTGGAGTAAACTGG + Intergenic
958439611 3:94139835-94139857 TTGCATCCAGTTAAGTAAAAAGG + Intergenic
960030816 3:113053164-113053186 ATTCATACATTAAAGTTAAAAGG - Intergenic
960624243 3:119665016-119665038 TTGCATAAACTGAAGAAAAAGGG - Intronic
962633345 3:137302264-137302286 CTGCCTCCATTGAATTGAAAAGG + Intergenic
962869046 3:139472390-139472412 CTGCCTGCATTCAAGGAAAAGGG - Intronic
966548260 3:181175670-181175692 ATGCATGCCTTGAAGGAAAATGG + Intergenic
967428691 3:189356921-189356943 TTGTATTCATTGAAGTTAAATGG + Intergenic
967794137 3:193580064-193580086 CTGGATATGTTAAAGTAAAAAGG + Intronic
970728313 4:19073103-19073125 ATGAATACATTGAACTACAAAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973899949 4:55458803-55458825 CTGCAGACATTGAGGTGGAATGG - Intronic
974727689 4:65816956-65816978 CTGCAGATATTGATGTAACATGG + Intergenic
976718101 4:88144783-88144805 CAGCATATATTGAAGACAAATGG - Intronic
977258337 4:94765353-94765375 ATGCATACATTGATGTAGATGGG - Intronic
977402649 4:96553330-96553352 CTGAATACATGGAGTTAAAATGG + Intergenic
978918798 4:114156692-114156714 CTGTATACATTTAACTTAAAAGG + Intergenic
979724363 4:123942637-123942659 CTGCCTTCATTGCAGGAAAAAGG - Intergenic
980436117 4:132776288-132776310 CTGAATACATGGAAGAAATAAGG + Intergenic
983041048 4:162927015-162927037 ATGTATACATTAAAGTATAATGG + Intergenic
983098352 4:163593348-163593370 CTGCATACATTGAAGTAAAAAGG + Intronic
984108011 4:175574590-175574612 CTGCATACAGTCAACTCAAAGGG + Intergenic
985215826 4:187652558-187652580 CTTGATACTTTGAAGAAAAACGG - Intergenic
985365288 4:189225255-189225277 CTACATAAATTGAATTATAATGG - Intergenic
986178031 5:5368551-5368573 GTGGAGACATTGAGGTAAAAAGG + Intergenic
987034106 5:14003029-14003051 CTGGATGCTTTGAAGCAAAAAGG + Intergenic
988329273 5:29814317-29814339 CTGCATATATTGTAATAAAATGG + Intergenic
988598676 5:32619404-32619426 CTGCTGACATGGATGTAAAATGG - Intergenic
989244359 5:39237315-39237337 GTGCATACATGGAAGTAAAAGGG + Intronic
990241876 5:53824139-53824161 CTCCATACTTTGAAGTCACATGG + Intergenic
991361590 5:65826474-65826496 CTGCATCTATTCAAATAAAATGG - Exonic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
992946104 5:81811850-81811872 TTGGATACATGGAAGTGAAATGG + Intergenic
995077263 5:108000986-108001008 CTGTGTACATTGAAATTAAAGGG - Intronic
1000524926 5:162345896-162345918 ATGCATATATTGAAGAATAATGG - Intergenic
1001432291 5:171672347-171672369 ATGCATACATGGTAGTAGAAAGG + Intergenic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1005468614 6:26140228-26140250 CTGCAGAAATTGAAGTAATTGGG + Intergenic
1010604809 6:77874916-77874938 TTGCATATATTGAACTAGAAAGG + Intronic
1012372384 6:98523399-98523421 CTGCAGGCATGGAAGTAAAATGG + Intergenic
1014195308 6:118550831-118550853 ATGCATAAATTGAATTTAAATGG - Intronic
1014816118 6:125937696-125937718 CTACATATATTGATATAAAATGG - Intergenic
1015138398 6:129900840-129900862 CTGCAGACATTGCAGGAACATGG + Intergenic
1015363197 6:132365332-132365354 CTGCCTCCCTTGAAGTTAAAAGG - Intronic
1015378774 6:132542673-132542695 CTGCATACCATGCAGTATAAAGG + Intergenic
1018196375 6:161359147-161359169 CTGCATGCAATGGAGTAATAAGG + Intronic
1018432408 6:163732608-163732630 ATGCTTACATTGAAGTAACTAGG - Intergenic
1021402366 7:20223822-20223844 CAGAATACATCGAACTAAAAAGG + Intergenic
1021833050 7:24637331-24637353 CTGCATACATTATATCAAAAAGG - Intronic
1022552813 7:31257874-31257896 CTACACACATTAAAGGAAAACGG - Intergenic
1023656176 7:42423113-42423135 GTGAAAATATTGAAGTAAAAGGG + Intergenic
1028449275 7:90962690-90962712 TTGCAAACATTGATTTAAAATGG - Intronic
1028876601 7:95830550-95830572 ATCCATACAATGAAATAAAAAGG - Intronic
1030761224 7:113354705-113354727 CTGTGGACATTGAATTAAAAGGG + Intergenic
1031646279 7:124230208-124230230 GTGCATTCATTGTAGTAAATAGG - Intergenic
1031692359 7:124804694-124804716 CTGAAGACAGTGAAGTATAATGG - Intergenic
1033963357 7:146942556-146942578 TTGCATAAATTAAAATAAAAAGG + Intronic
1034578659 7:152024414-152024436 CTGCAACCATTGAAGGAAACTGG + Intergenic
1041650620 8:60298822-60298844 CTGAGTACATTGAACTAAAAGGG + Intergenic
1041717138 8:60942724-60942746 CTGCCTACACTCAAGGAAAAGGG + Intergenic
1044913569 8:97088069-97088091 CAACATACTATGAAGTAAAAGGG - Intronic
1045274794 8:100693714-100693736 ATGCATACCCTGAAGAAAAATGG + Intronic
1047783646 8:128132549-128132571 CTACAGAGATTTAAGTAAAATGG - Intergenic
1047869072 8:129062305-129062327 CAGAATACACTGAACTAAAAGGG + Intergenic
1048451496 8:134537655-134537677 CTGGATACCTGGAAGTTAAATGG + Intronic
1050578996 9:7030708-7030730 AGGCATATATTGAAATAAAATGG - Intronic
1050739330 9:8802234-8802256 ATGCATCCATTAAAGTGAAATGG + Intronic
1051072083 9:13182174-13182196 CTGCATAAATTGAATTCAATGGG - Intronic
1051332230 9:16034430-16034452 CTTCCCACAATGAAGTAAAAAGG - Intronic
1052477392 9:28977661-28977683 CTGTATACATACATGTAAAATGG + Intergenic
1053457781 9:38244255-38244277 GTGCAAACTTTGAAGTACAAGGG - Intergenic
1056722125 9:89081623-89081645 CTGAATGCATTGAATTAGAAAGG - Intronic
1058121082 9:101139668-101139690 ATGCTTACCTGGAAGTAAAATGG - Intronic
1059288348 9:113197773-113197795 CTTCAGTTATTGAAGTAAAATGG - Intronic
1059882848 9:118710848-118710870 CTGCATACATAGAAGGCAGATGG + Intergenic
1059919859 9:119147775-119147797 CTTCATAAAATAAAGTAAAATGG + Intergenic
1060033390 9:120234608-120234630 CAGCATATATTGAAAGAAAAAGG - Intergenic
1062719571 9:138030813-138030835 CTGTATACACTTAAATAAAAGGG - Intronic
1203432749 Un_GL000195v1:106226-106248 ATGCATACATTGAACAAAATTGG + Intergenic
1203433758 Un_GL000195v1:118356-118378 ATGCATACATTGAACAAAATTGG - Intergenic
1186171231 X:6879191-6879213 CTACATGCAGTGAAGGAAAAAGG + Intergenic
1188397020 X:29697622-29697644 CTCCAGACATTTAAGTAAAGTGG + Intronic
1188837959 X:34981775-34981797 CTGAATAGAATGAGGTAAAAGGG - Intergenic
1189264133 X:39700599-39700621 CTACGTGCATTGAAGTACAAGGG + Intergenic
1192980678 X:76337149-76337171 CAGAATACATTTAAGTAAGAAGG + Intergenic
1194109921 X:89820942-89820964 TTGCATATATTGCAGTAACATGG - Intergenic
1196648188 X:118140599-118140621 ATGCATACATTTAAGTTCAAAGG + Intergenic
1197152826 X:123238697-123238719 TTGCAAACATTGTAGGAAAAGGG + Intronic
1197410871 X:126114842-126114864 CTGTCCACATTGAAGTGAAAAGG - Intergenic
1197926011 X:131647420-131647442 CTGCCTAGATTCAAGTAAAGTGG + Intergenic
1198891959 X:141406811-141406833 CTACATACATTATTGTAAAAAGG - Intergenic
1201857105 Y:18556834-18556856 CTGGAAACATGGAGGTAAAATGG - Intronic
1201876216 Y:18763546-18763568 CTGGAAACATGGAGGTAAAATGG + Intronic