ID: 983099949

View in Genome Browser
Species Human (GRCh38)
Location 4:163612963-163612985
Sequence TCATGGTGCTGAGCCCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983099949_983099954 25 Left 983099949 4:163612963-163612985 CCTAGCAGGGCTCAGCACCATGA 0: 1
1: 0
2: 0
3: 28
4: 261
Right 983099954 4:163613011-163613033 TTCTGACATGTCATGCAAGATGG 0: 1
1: 0
2: 2
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983099949 Original CRISPR TCATGGTGCTGAGCCCTGCT AGG (reversed) Intronic
901232663 1:7649850-7649872 AGCTGATGCTGAGCCCTGCTAGG + Intronic
901638356 1:10680693-10680715 ACTTGCTGCTGAGCCCAGCTGGG + Intronic
901840092 1:11948819-11948841 CCATGGGGCTGAGCCCTGCAGGG + Intronic
902554657 1:17239884-17239906 TCATGGTCCTGGGGGCTGCTGGG + Intronic
902966065 1:20003711-20003733 ACATAGTGCTGAGACCAGCTCGG - Intergenic
903604299 1:24563850-24563872 TCAGGGTTAAGAGCCCTGCTGGG - Intronic
904625647 1:31800447-31800469 CCATGGTGCAGGGCCCTGCTGGG - Exonic
904673071 1:32180327-32180349 TCATTGTGATGAGCGATGCTGGG - Exonic
904852178 1:33467521-33467543 ACATGGTGCTGAGCCCAACCTGG + Intergenic
905267519 1:36765040-36765062 TCTTGGTGCTCAGCCCGGCAGGG + Intergenic
907334285 1:53690221-53690243 TCGTGGTGCCGAGCGTTGCTGGG - Intronic
907460973 1:54605292-54605314 CCATGATGCTCTGCCCTGCTGGG + Intronic
909402999 1:75255114-75255136 ACATGGTGCAGAGGCCTCCTTGG + Intronic
910631085 1:89355050-89355072 TCAAGGTGTTGAGTCCTCCTGGG + Intergenic
912460625 1:109828582-109828604 TAATGGTGCTGAGCACTTCATGG + Intergenic
912656831 1:111493484-111493506 GCATGGTGCTGGGACCTGTTTGG - Intronic
912811808 1:112800730-112800752 TCATGGGGCTCAGCCCAGGTAGG + Intergenic
914860823 1:151384495-151384517 CCATGATGCTGAGCTCTGCTAGG + Intergenic
917135659 1:171786038-171786060 TCATGGAGCTGGCCCCAGCTGGG + Exonic
917241900 1:172957544-172957566 TGCTGGAGCTGAGTCCTGCTGGG + Intergenic
917248023 1:173025556-173025578 TCATGGAGGTGAGGCCTGGTGGG - Intergenic
920708373 1:208271996-208272018 TCATGCTGCTGGGCTCTGCTCGG + Intergenic
922493957 1:226041306-226041328 TTAGGCTGCTGAGCACTGCTGGG + Intergenic
923934203 1:238743640-238743662 TCATGGTGTTCTGCCCTGCCAGG + Intergenic
924550637 1:245072943-245072965 GCATGGTGCTGACATCTGCTTGG - Intronic
924554572 1:245107675-245107697 TCCTGGTTCTCAGTCCTGCTCGG + Intronic
1063826899 10:9908455-9908477 GCATGGTGCTGACATCTGCTTGG + Intergenic
1064056297 10:12100401-12100423 GCATGGTGGTGCGCCCTACTTGG - Intronic
1064584059 10:16822088-16822110 ACATGGTGCTGACATCTGCTTGG - Intergenic
1066527321 10:36295910-36295932 TCAGGGTGCTGAGCTCTCCTAGG + Intergenic
1067046755 10:42989546-42989568 TCCGGGTGCTGGGCCCTGCCTGG + Intergenic
1067084732 10:43231761-43231783 TGCTGGGGCTGAGCCCTGCCAGG + Intronic
1067187441 10:44042963-44042985 ATGTGGGGCTGAGCCCTGCTAGG - Intergenic
1067321904 10:45229123-45229145 ACATGGTGCTGATATCTGCTTGG - Intergenic
1068733480 10:60386089-60386111 TCATGGACCAGGGCCCTGCTGGG + Intronic
1069748338 10:70730186-70730208 TCATGGTGCTCAGCGTGGCTGGG - Exonic
1069841124 10:71340059-71340081 TCATGGTGCTCAGCCCTGGCTGG - Intronic
1070465483 10:76718754-76718776 TAAAGGTTCTGAGCCCTGCTGGG - Intergenic
1071436591 10:85653420-85653442 GGATGGGGCTGAGGCCTGCTGGG + Intronic
1072197080 10:93125501-93125523 GCATGGTGCTGACATCTGCTTGG + Intergenic
1072626468 10:97115552-97115574 TCAGGGAGCTGAGGGCTGCTGGG - Intronic
1073102116 10:101011880-101011902 TCTGGGTCCTGAGCCCTGCTGGG - Intronic
1073145227 10:101276458-101276480 GCATCTTGCTGGGCCCTGCTGGG + Intergenic
1073564126 10:104520899-104520921 GCATGGTGCTTAGCGCTGCCTGG + Intergenic
1075331834 10:121579691-121579713 TCCGGCTCCTGAGCCCTGCTGGG - Intronic
1075427623 10:122354049-122354071 TCATGGTGCTGGCATCTGCTTGG - Intergenic
1075958179 10:126543559-126543581 CCATGGTACTGAGTCCTGATGGG - Intronic
1078157074 11:8808259-8808281 TCATCCTGCTGGGTCCTGCTGGG - Intronic
1079571940 11:21953587-21953609 TCAGGGTGATGAGGTCTGCTAGG - Intergenic
1079958596 11:26894517-26894539 TCATGGTGCTGACATCTGCTTGG - Intergenic
1079973151 11:27060365-27060387 GCATGGTGCTGACATCTGCTTGG - Intronic
1083964925 11:66037573-66037595 GCATGGTGCTGACATCTGCTCGG - Intergenic
1084743084 11:71151515-71151537 TCATTCTCCTGGGCCCTGCTGGG + Intronic
1086068836 11:82776420-82776442 TCAGGGTGGTGAGCTCTGCGAGG - Intergenic
1089027955 11:115291526-115291548 TCATGCTACTGAGCGCTGCGGGG - Intronic
1090629295 11:128632522-128632544 GCATGGTGCTGGGAGCTGCTGGG + Intergenic
1091172170 11:133528945-133528967 TCATGGTGCTGGCCCCTGGAAGG + Intronic
1091238529 11:134037274-134037296 TCTGGGTGCTGGGCCGTGCTGGG + Intergenic
1091705171 12:2688709-2688731 TCATGGTGCCCAGCCAGGCTGGG + Exonic
1094475750 12:30839450-30839472 TCATGTTGATGAGCCCTGAGGGG - Intergenic
1095386906 12:41661314-41661336 TCAGGGTGCTGATCCAGGCTGGG - Intergenic
1096239251 12:49950812-49950834 ACATGCTGCAGAGCCCTGCGGGG - Exonic
1096693180 12:53333476-53333498 TCATGGTGCAGTGCCCAGCCTGG + Intronic
1097119396 12:56719867-56719889 TCTTGGTGGTGAGTCCTGCTTGG + Exonic
1097202951 12:57295175-57295197 ACATGGTGCTGAGGTTTGCTAGG - Intronic
1098610615 12:72452876-72452898 TCATGATGCTGACCTCTGCTTGG - Intronic
1099475906 12:83107357-83107379 GCATGGTGCTGGTACCTGCTCGG + Intronic
1103727110 12:123003466-123003488 TCCTGGTGCAGAGGCCAGCTCGG + Intronic
1103882443 12:124176499-124176521 TCAGAGTCCTGAGCCCTTCTAGG + Intronic
1104068764 12:125327289-125327311 AGAAGGTGCTGAGCTCTGCTTGG - Intronic
1104370090 12:128216651-128216673 GCATGGTACTGACACCTGCTCGG - Intergenic
1110027915 13:70565426-70565448 TTATTGTGCTGAGACCAGCTAGG - Intergenic
1112223932 13:97518976-97518998 GCATGGTGCTGACATCTGCTTGG + Intergenic
1112240352 13:97675298-97675320 CCATCGTGCTCAGCGCTGCTGGG - Intergenic
1112629798 13:101148287-101148309 TCATGATTCTCAGCCATGCTCGG + Intronic
1113636088 13:111920070-111920092 CCATGGAGCTGGGCCCAGCTGGG + Intergenic
1113832909 13:113310951-113310973 TCCTGGTGCTGGGCTCTGCCTGG + Intronic
1113979340 13:114260424-114260446 TGATGCTGCTGAGCCCGTCTGGG - Intronic
1114647448 14:24263546-24263568 TCATAGGGCTGAGCCTGGCTTGG - Intronic
1116171981 14:41414751-41414773 ACAAGGTGCTGTGCCATGCTAGG - Intergenic
1117619526 14:57570196-57570218 TTATGGTGCTGAAAACTGCTGGG + Intronic
1119711848 14:76828155-76828177 TCAAGGTGCCAAGCCCTGCCAGG - Intronic
1119877562 14:78073839-78073861 TCAGGGTGCTGACACCTGCTGGG + Intergenic
1120711507 14:87797929-87797951 TATTGGTGCTGAGTCCTGCAGGG + Intergenic
1121127210 14:91416082-91416104 TCCTGTTGCTGAGCTCTGCACGG - Intronic
1121314618 14:92953548-92953570 TCAGGGGGCTGAGCCAGGCTGGG - Intronic
1121343031 14:93116164-93116186 TGGGGGTGCTGAACCCTGCTGGG - Intronic
1122874864 14:104659356-104659378 TGATGTTGCTGAGACCTGCATGG - Intergenic
1123508708 15:20972899-20972921 TCCTGGTGCTGAGCTGGGCTTGG - Intergenic
1123565932 15:21546648-21546670 TCCTGGTGCTGAGCTGGGCTTGG - Intergenic
1123602189 15:21983935-21983957 TCCTGGTGCTGAGCTGGGCTTGG - Intergenic
1124616395 15:31245365-31245387 TCCTGGTCCTGATCCCAGCTTGG - Intergenic
1129523364 15:76199455-76199477 CCAGGGTGATGAGCCCTCCTTGG + Intronic
1130878169 15:88032215-88032237 TCCTTCTGCTGAGCCCTGCTAGG - Intronic
1130999275 15:88925480-88925502 AGATGGTGCTGAGACCAGCTTGG - Intergenic
1202974296 15_KI270727v1_random:273741-273763 TCCTGGTGCTGAGCTGGGCTTGG - Intergenic
1132644498 16:992543-992565 TCCGGGTGCTGAGCATTGCTGGG + Intergenic
1132721971 16:1320948-1320970 TCACGTCACTGAGCCCTGCTGGG - Intronic
1136356491 16:29747642-29747664 TGGTGGTTTTGAGCCCTGCTGGG + Intergenic
1138848635 16:60598713-60598735 TCCTAGAGCTGAGCCCTCCTAGG - Intergenic
1139051509 16:63129871-63129893 TGCAGGTCCTGAGCCCTGCTGGG - Intergenic
1139726139 16:68900338-68900360 TTAAGACGCTGAGCCCTGCTAGG + Intronic
1140069117 16:71634094-71634116 TCAGGGGTCTGAGCCCTGCGCGG + Intronic
1142002371 16:87671053-87671075 TCCGGGTGCAGGGCCCTGCTGGG - Intronic
1142151157 16:88513087-88513109 TCTTGGTGCCAAGCCCTGCAGGG + Intronic
1142249235 16:88983501-88983523 GCATGGGGCTGAGCCCAGCAGGG + Intergenic
1142841621 17:2636014-2636036 TCAAGAGGCTGAGCCCAGCTTGG + Intronic
1144185699 17:12793220-12793242 TCCTAGTGCTGAGCACTGCTAGG - Intronic
1145056616 17:19707534-19707556 TCACGATGCAGAGCCCTGCTGGG - Intronic
1145486517 17:23763414-23763436 TCACGGTGCTGAACCTTTCTTGG + Intergenic
1145576419 17:25071468-25071490 TCACGGTGCTGAACCTTTCTTGG + Intergenic
1145662552 17:26323608-26323630 TCACGGTGCTGAACCTTTCTTGG + Intergenic
1145676736 17:26530343-26530365 TCACGGTGCTGAACCTTTCTTGG + Intergenic
1148474310 17:47916925-47916947 TCATTGTTCAGAGCCCTGGTGGG + Exonic
1150178826 17:63092573-63092595 TCATGGTGCTGGCATCTGCTTGG + Intronic
1151408353 17:73903817-73903839 CCCTGGTGCTGAGACCTGTTGGG + Intergenic
1152061544 17:78079555-78079577 TCCTGTTGCTCAGTCCTGCTTGG - Intronic
1152128274 17:78460483-78460505 TTATGGAGCTCAGACCTGCTGGG - Intronic
1152213441 17:79017671-79017693 AAATGATGCTGAGACCTGCTGGG + Intergenic
1152382022 17:79947069-79947091 TGGTGGGGCTGAGCCCAGCTGGG - Intronic
1152930336 17:83106051-83106073 GCACGTCGCTGAGCCCTGCTGGG - Intergenic
1153744410 18:8162542-8162564 TCAGGGTGAGGAGCCATGCTGGG - Intronic
1153800459 18:8663529-8663551 TTCTGCTCCTGAGCCCTGCTGGG - Intergenic
1154987808 18:21569951-21569973 TCAAGGTGCTGTGCTGTGCTAGG - Intronic
1155993124 18:32301600-32301622 TGGTGCTGCTGAGCCCTGATTGG - Intronic
1156382716 18:36578578-36578600 TCACAGTGCTGTGCTCTGCTGGG + Intronic
1156508258 18:37612897-37612919 GCATTGTGCTGAGCCAGGCTGGG - Intergenic
1157396649 18:47347144-47347166 GCATGGTGCTGACATCTGCTTGG + Intergenic
1158516158 18:58131652-58131674 TGATGGTGTTGAGCTCTGTTGGG + Intronic
1158969792 18:62655934-62655956 TCATGGTGCTGGCCTCTGCGCGG + Intergenic
1161389480 19:4013770-4013792 TCATGGTGCGGACTCCTGCACGG + Intronic
1161570605 19:5028814-5028836 CCCTGGTGCTGAGTGCTGCTGGG + Intronic
1161575841 19:5053825-5053847 GGCTGGTGCTGAGCGCTGCTGGG - Intronic
1163737720 19:18991681-18991703 TCAATGGGCTGAGCCCCGCTTGG + Intronic
1165323154 19:35098760-35098782 TGGTGGCGCTGAGCCCTGCCAGG + Intergenic
1165448096 19:35867926-35867948 GCATGGTGCTGGTGCCTGCTTGG + Intronic
1165778472 19:38418439-38418461 TGATGGTGCTGAGCCGTCCCGGG - Exonic
1166252079 19:41578077-41578099 TCTGGGGGCTGAGCCCTGCCTGG - Intronic
1166495834 19:43302618-43302640 TCTTGGGGCTGAACCCTGCCTGG + Intergenic
1166997494 19:46726708-46726730 GCATGGTGCTGAGGCTTGCCTGG - Intronic
1167159218 19:47756435-47756457 GCATGGGGCTGAGCCCTGCCAGG + Intronic
1167676492 19:50889653-50889675 TCATGTGGCTGTGCCCAGCTGGG + Intergenic
925289734 2:2739433-2739455 GCATGGTGCTGAGGCCTGGGTGG - Intergenic
925490271 2:4383722-4383744 AAATTGTGCTGAGCTCTGCTTGG - Intergenic
925952843 2:8931352-8931374 GCATGGTGCTGACATCTGCTTGG + Intronic
926000837 2:9331127-9331149 GCTGGGTGCTGTGCCCTGCTGGG + Intronic
926315226 2:11704771-11704793 CCATGGAGCAGAGCCCTGCAGGG - Intronic
926961142 2:18359662-18359684 TCATGGCCCTGACCCATGCTTGG - Intronic
928318823 2:30267122-30267144 GCATGGTGCTGATATCTGCTTGG + Intronic
931998435 2:67861415-67861437 TGATGGGGCTGAGCCCTCCTGGG - Intergenic
933791013 2:85883680-85883702 TCAGGGTGCTGTGCCCTCCTGGG - Intronic
934769371 2:96898248-96898270 TCATGGTGAAGTGCCCTGCTGGG - Intronic
935097772 2:99962023-99962045 TCATGTTTCTGAGGCCTGGTAGG - Intronic
935783737 2:106530664-106530686 AGATGGGGCTGAGACCTGCTAGG + Intergenic
936800983 2:116265580-116265602 TCATGGTTCTGAACACTGATAGG + Intergenic
937950433 2:127382983-127383005 GCATGGTGCTGGCACCTGCTTGG + Intronic
938243933 2:129763184-129763206 TCATGCTGCTGAGCTCTTCCTGG - Intergenic
943844449 2:192626068-192626090 TCATGGTGCTGACATCTTCTTGG + Intergenic
943858770 2:192832974-192832996 TCTTGGTGCTAATCCTTGCTTGG - Intergenic
944714176 2:202362351-202362373 AAATGATGCTGAGACCTGCTGGG - Intergenic
945844707 2:214930374-214930396 TCACGGTCCAGAGCCCAGCTGGG + Intergenic
946031761 2:216710987-216711009 ACAGGGAGCTGAGCCATGCTTGG + Intergenic
946060541 2:216937266-216937288 TCACTGTGCAGAGCCCTGCAGGG + Intergenic
948468188 2:238162117-238162139 TCCTGGTGCTGCCTCCTGCTTGG + Intronic
948544006 2:238712614-238712636 TCATCGTGCTGTGCACTGCAGGG + Intergenic
1168952037 20:1809097-1809119 TAATTGGGCTCAGCCCTGCTGGG - Intergenic
1169737185 20:8849725-8849747 CCATCGCGCTCAGCCCTGCTTGG - Intronic
1171103001 20:22403693-22403715 TGTTGGCGCTGAGCCTTGCTAGG + Intergenic
1171126410 20:22605734-22605756 TCATGGTGCTGCTACCTGCCAGG + Intergenic
1173541616 20:43856787-43856809 TCTTGGTGCAAACCCCTGCTTGG + Intergenic
1173569443 20:44067044-44067066 GCCTGATGCTGAGGCCTGCTTGG + Intronic
1173743047 20:45416113-45416135 TCATGGGGCCGAGCGCCGCTGGG + Exonic
1176088020 20:63306878-63306900 TCAGGGTGCTGGGCTCTGCTGGG + Intronic
1176089015 20:63310777-63310799 TCATGGAGCTCCCCCCTGCTTGG + Intronic
1176178249 20:63738556-63738578 GGATGGTGCTGACCCCTCCTCGG + Intronic
1179605359 21:42512699-42512721 TCCTGGGGCTGAACCCTGCGTGG + Intronic
1180185569 21:46137529-46137551 CTGTGGGGCTGAGCCCTGCTTGG - Intronic
1180726902 22:17953053-17953075 TTATGCTCCTGAGCCCTGCTGGG - Intronic
1181167907 22:20993152-20993174 CTCTGGTGCTGAGCCCAGCTTGG - Intronic
1181425886 22:22838451-22838473 TTATGGGGCTGAGCCCTGGAAGG - Intronic
1182138510 22:27930862-27930884 TCTTGGTGCTGAACTGTGCTGGG - Intergenic
1183225584 22:36547759-36547781 TCGTGGTGCTAAGCACTTCTTGG + Intergenic
1183548332 22:38467322-38467344 TCCTGGTGCTCAGCCCTCCTGGG + Intergenic
1183731944 22:39623048-39623070 TCACAGTGCTGCCCCCTGCTGGG - Intronic
1183977193 22:41519189-41519211 TCAGGGTGCCTAACCCTGCTGGG - Intronic
1184299122 22:43544554-43544576 CCACAGTGCTGAGCTCTGCTGGG + Intronic
1185053034 22:48563598-48563620 TCCTGGAGCTCAGCGCTGCTGGG + Intronic
949871006 3:8588905-8588927 TCATTGTGATAAGCCCTGCAGGG - Intergenic
949892712 3:8745274-8745296 TCATGGTGCTGGCATCTGCTTGG - Intronic
951284024 3:20787716-20787738 TCATCTTGCTGTCCCCTGCTTGG - Intergenic
951724932 3:25747196-25747218 TCATTGGGCTGGGCCCTGCAGGG - Intronic
951934147 3:28002991-28003013 GCATGGTGCTGACATCTGCTAGG + Intergenic
952920957 3:38283494-38283516 AAATGGTGCTGGGCTCTGCTGGG + Intronic
954214561 3:49117160-49117182 TCTTGGCGCTGGGCCCTGCCTGG + Exonic
954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG + Intergenic
955345899 3:58161692-58161714 TCATTGAGCTGCGCCCTGCAAGG + Intronic
956210658 3:66798361-66798383 TCATTGTCCTGCCCCCTGCTTGG - Intergenic
959649221 3:108735542-108735564 TCATGGAGCTAAGCCCTGAAGGG - Intergenic
960963598 3:123089635-123089657 GCATGGGGCCGAGCCCTGCCAGG + Intronic
961516719 3:127442579-127442601 TCCTGGTGCTGAGTGGTGCTTGG - Intergenic
962728504 3:138257861-138257883 TCCTTGTGCTGCACCCTGCTTGG + Intronic
963142665 3:141960531-141960553 TCATGGGCCTCAGCCCTGCAGGG + Intronic
964750819 3:160052267-160052289 TTCTGGTGCTGTGCCATGCTTGG + Intergenic
966272886 3:178130118-178130140 TCATGTTGCGGAGACCAGCTCGG + Intergenic
967214330 3:187197733-187197755 ACAATGTGCTGAGCCCTGGTTGG + Exonic
968298988 3:197599147-197599169 TCCTGCCTCTGAGCCCTGCTGGG - Intergenic
968932211 4:3587120-3587142 TCATGGAGCTGGGAGCTGCTGGG + Intronic
969709398 4:8834101-8834123 TCCTACTGCTGGGCCCTGCTTGG - Intergenic
970440939 4:16080767-16080789 TGGTGGAGCTGAGCCATGCTGGG + Intronic
972091721 4:35294836-35294858 GCATGGTGCTGACATCTGCTTGG - Intergenic
975353347 4:73370256-73370278 TAATAGTGCTGAGACCAGCTCGG - Intergenic
976497356 4:85745874-85745896 TCATGCTGCAGAGCCAGGCTAGG - Intronic
976658817 4:87517877-87517899 TCATGGTGTTGGGACCTTCTGGG + Intronic
977050932 4:92128197-92128219 TCATGATGCTGAGGCCCTCTGGG - Intergenic
977527905 4:98166631-98166653 TCATAGTGCTGAGCTGGGCTTGG - Intergenic
978415848 4:108475010-108475032 TCATGGTGCTGTCATCTGCTCGG - Intergenic
983099949 4:163612963-163612985 TCATGGTGCTGAGCCCTGCTAGG - Intronic
985124886 4:186683322-186683344 GGATGGTGCTGTGCCCTTCTTGG - Intronic
985724150 5:1506901-1506923 CCAGGGTGCTGGGCCTTGCTTGG - Intronic
987631395 5:20477732-20477754 TCCTGGTGCTGAGCTGGGCTTGG + Intronic
988202217 5:28083169-28083191 TCATGGGGCTGAGGACAGCTGGG + Intergenic
988593210 5:32567296-32567318 GCATGGTGCTGGGATCTGCTTGG - Intronic
988915026 5:35883483-35883505 GCATGGTGCTAAGATCTGCTTGG - Intergenic
989645533 5:43628227-43628249 TCTTGGTGCTGAGCCCTTGGAGG + Exonic
990510953 5:56488566-56488588 TCCTGTTGCTGATCCCTGTTTGG + Intergenic
994500067 5:100564139-100564161 GCATGGTGCTGACATCTGCTTGG - Intronic
997406283 5:133649978-133650000 GCATGGTGCTGAAATCTGCTTGG + Intergenic
998857450 5:146406956-146406978 ACTTGGTTTTGAGCCCTGCTTGG - Intergenic
1000370997 5:160536502-160536524 ACATGAGGCTGAGACCTGCTGGG + Intergenic
1000509321 5:162162711-162162733 GCATGGTGCTGATATCTGCTTGG - Intergenic
1002467240 5:179413747-179413769 CCCGGGTGCTGTGCCCTGCTGGG - Intergenic
1003402905 6:5805597-5805619 TCCTGGAGGTGAGGCCTGCTGGG + Intergenic
1005992776 6:30913913-30913935 TCATGGTGGTGACCCCGGCCGGG + Exonic
1006796863 6:36737543-36737565 TCTTGCTCCTGAGCCCTGCTGGG + Intergenic
1007423368 6:41733095-41733117 TCTTGGCCCTGAGCCCTCCTGGG - Intronic
1007494833 6:42252584-42252606 CCTTTGTGCTGAGCCCTGTTGGG - Intronic
1010661280 6:78573159-78573181 GCATGGTGCTGACATCTGCTTGG + Intergenic
1014798336 6:125749708-125749730 TCAGGGTGCTGCGCCCCGCTCGG + Exonic
1019625867 7:2015353-2015375 CCAGGAAGCTGAGCCCTGCTGGG - Intronic
1020220304 7:6231486-6231508 TCCTGGAGATGAGCACTGCTGGG - Intronic
1020557438 7:9688533-9688555 GCATGGTGCTGACATCTGCTTGG - Intergenic
1021202435 7:17741646-17741668 CCAAGGTGCTGGGCCCTGCCTGG - Intergenic
1023807546 7:43884326-43884348 TCATGGAGCTGAGCCCTCAGTGG - Intronic
1026202658 7:68228001-68228023 TCATGTTGCTGGGCTCAGCTGGG - Intergenic
1026977566 7:74507817-74507839 TCCTGGTGCTGGGCTCAGCTTGG + Intronic
1031267098 7:119594992-119595014 GCATGGTGCTGACACCTGCGCGG + Intergenic
1032317804 7:130856037-130856059 TATTTGTGCTGAGACCTGCTGGG + Intergenic
1034202926 7:149293754-149293776 GCATGGTGCTGGGCGCTGCAGGG + Intronic
1034467444 7:151238309-151238331 TCCTGGTGCTGACCCCTCCCGGG + Exonic
1034855676 7:154544453-154544475 TCATGGTGCTGAGCACTATGTGG - Intronic
1035241937 7:157537878-157537900 GTTTGGAGCTGAGCCCTGCTAGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036929044 8:12935400-12935422 GCATGGTGCTGACATCTGCTTGG + Intergenic
1037449207 8:19000017-19000039 TCATATTGCTGTGTCCTGCTTGG - Intronic
1039743398 8:40402406-40402428 GCATGGTGCTGGCACCTGCTTGG + Intergenic
1044758049 8:95487314-95487336 TCATGGTACAGAGCAGTGCTTGG + Intergenic
1044896634 8:96899493-96899515 GCATGGTGCTGACATCTGCTCGG + Intronic
1047851874 8:128865789-128865811 GCATGGTGCTGGCACCTGCTTGG - Intergenic
1048303150 8:133266014-133266036 TCAGGCTGCTGAGACCTGCCAGG + Intronic
1048784990 8:138041010-138041032 TGCTGGTGCTGAGTCCTGCTGGG - Intergenic
1049214579 8:141401890-141401912 TCATGGGACTGGGCCCTGCTGGG - Intronic
1049225759 8:141449793-141449815 TCATGTGGCTGAGCCCAGCCAGG - Intergenic
1054457923 9:65444808-65444830 TCATGGAGCTGGGAGCTGCTGGG - Intergenic
1055754449 9:79543002-79543024 TCAGGGTGCTGTGGCCTCCTTGG + Intergenic
1055784551 9:79858816-79858838 TCATACAGCTGAGCCCTGATTGG - Intergenic
1056110749 9:83392229-83392251 TCAGGGTGGTGAGGCTTGCTGGG - Intronic
1056385772 9:86095687-86095709 TCTTGGTTTTCAGCCCTGCTGGG - Intronic
1059665639 9:116443927-116443949 TCAGAATGCTGAGCCCTGATTGG + Intronic
1060759116 9:126233777-126233799 GGATGGGGCTGAGCCCTGATTGG + Intergenic
1061193504 9:129095318-129095340 CCAAGGAGCTGAGCCCTGGTGGG + Exonic
1061500848 9:131001049-131001071 TCATGGTCCTGAGCTCTGGAGGG + Intergenic
1061506613 9:131035308-131035330 TCATGGTGCTGGCATCTGCTTGG + Intronic
1061892818 9:133631703-133631725 TCTTGGGGCTGAGGCCTGCTGGG - Intergenic
1062253197 9:135608561-135608583 CCCAGGTTCTGAGCCCTGCTTGG - Intergenic
1062643652 9:137534865-137534887 TCCTGGTGTTTGGCCCTGCTGGG - Intronic
1185633221 X:1531780-1531802 TCATGCCGCTGAGCCGGGCTGGG - Intronic
1185703713 X:2250776-2250798 ACATGAGGCTGAGACCTGCTTGG - Intronic
1185785799 X:2889988-2890010 ACATGAGGCTGAGACCTGCTGGG - Intergenic
1185849296 X:3470334-3470356 ACATGAGGCTGAGACCTGCTGGG + Intergenic
1186213422 X:7273912-7273934 CCATGGTGCTCAGCCCTGATGGG + Intronic
1186486428 X:9937437-9937459 TCATGTAGCTGAGCCCTGGAGGG - Exonic
1187177068 X:16905359-16905381 GCATGGTGCTGACATCTGCTTGG - Intergenic
1189315774 X:40055434-40055456 TTATGGTGCTGACCCCACCTTGG - Exonic
1191760454 X:64642624-64642646 TCATTGTGCAGAGCTCAGCTGGG - Intergenic
1192145665 X:68680640-68680662 TGTTGGTGCTGTGCCCTGCCAGG + Intronic
1198576085 X:138011701-138011723 TCCTGCTGCTGTGCCCTACTGGG - Intergenic
1199351167 X:146802441-146802463 GCATGGTGCTGACACCTGTTTGG - Intergenic
1199352740 X:146822052-146822074 GCATGGTGCTGACACCTGTTTGG + Intergenic
1201146819 Y:11069273-11069295 TCATTCTCCTGGGCCCTGCTGGG + Intergenic
1201288058 Y:12395832-12395854 ACATGAGGCTGAGACCTGCTGGG + Intergenic