ID: 983113258

View in Genome Browser
Species Human (GRCh38)
Location 4:163780314-163780336
Sequence GAATCACTCTTTGCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983113258 Original CRISPR GAATCACTCTTTGCCAGGAC AGG Intronic
905359423 1:37408896-37408918 CAATCACTCTTGTCCAGGCCTGG - Intergenic
908454228 1:64286295-64286317 GAATGTCTCTTTGTCAGGAAGGG + Intergenic
909046311 1:70714301-70714323 GAATCACTTCTGGCCAGGAGAGG + Intergenic
910004939 1:82385030-82385052 CAGTCACTGTTTGCCAAGACAGG + Intergenic
910278391 1:85472024-85472046 GAATCCCTCTTCCCCAGGGCGGG + Intronic
910501483 1:87896545-87896567 GAATAACTGTTTGCCATGACTGG + Intergenic
911203470 1:95069782-95069804 GAATCTCTCTTCCCCAGGGCGGG + Intronic
912563947 1:110571678-110571700 GAAGCACTTTCTGCCAGGATGGG - Intergenic
916489082 1:165285698-165285720 GAAGCATTCTTAGCCAGGATGGG + Intronic
917922962 1:179766173-179766195 GAATCTCTCTTCCCCAAGACAGG + Intronic
918579703 1:186111357-186111379 GAATCACTCTGAGCCAGGTGTGG + Intronic
920400818 1:205675346-205675368 GAATCCCTCTTTTCCAGGGCAGG - Intronic
924848215 1:247794484-247794506 GAATGATTCTTTTGCAGGACAGG - Intergenic
1068067949 10:52155827-52155849 AAATCAGTCTTTTCCAGGACAGG - Intronic
1070216919 10:74394797-74394819 GAATTACTATTTGCCAGAAATGG - Intronic
1072768103 10:98112391-98112413 GAATCACTCTTAGCCTGGTTAGG + Intergenic
1080266694 11:30408644-30408666 TAATCATTCTTTGTCTGGACTGG - Intronic
1080797000 11:35574142-35574164 GAATCCCTCTTCCCCAGGACAGG - Intergenic
1081431895 11:42985553-42985575 GCATCACTCTAAGCCAGGAACGG - Intergenic
1081463329 11:43291831-43291853 GAACAACCCTTTGACAGGACAGG + Intergenic
1083883914 11:65561563-65561585 GTCTCACTCTGTGCCAGGGCTGG + Intergenic
1086131471 11:83406547-83406569 CCACCACTCTTTTCCAGGACTGG + Intergenic
1088675785 11:112191497-112191519 GAATCACTCTATTCAAGAACAGG - Intronic
1091948304 12:4568969-4568991 GCATCACTGTTTGGCAGAACTGG + Intronic
1092826043 12:12399742-12399764 GACACAGTCTTTGGCAGGACAGG - Intronic
1093051676 12:14511574-14511596 CACGGACTCTTTGCCAGGACAGG + Exonic
1093935391 12:24995211-24995233 GTTTCACTCTTTGCCCAGACTGG + Intronic
1095827786 12:46548216-46548238 GATTCACTCTTTGCCTAGATTGG - Intergenic
1095839432 12:46676176-46676198 GTCTCACTCTGTGCCTGGACTGG - Intergenic
1097185306 12:57193437-57193459 GAACCACTGTTAGCCTGGACTGG + Intronic
1100546204 12:95605122-95605144 AACTTACTCTCTGCCAGGACAGG + Intergenic
1104376985 12:128272202-128272224 TAATCAGTGGTTGCCAGGACTGG - Intronic
1116680230 14:47959031-47959053 GAACCCCTCTTCGCCAAGACAGG - Intergenic
1116982610 14:51187592-51187614 AAATCTCTCTTTCCTAGGACTGG + Intergenic
1120561581 14:86000703-86000725 GACTCACTCTTTGTCCAGACTGG + Intergenic
1124231394 15:27948913-27948935 AGATCAGTCCTTGCCAGGACCGG + Intronic
1125375326 15:39022739-39022761 GAATCACTCTTATGCAAGACAGG - Intergenic
1127584048 15:60365438-60365460 GAAACAGTCTTTGCCATAACTGG + Intronic
1130435866 15:83898904-83898926 AAATCACTAGTTGCCATGACAGG + Intronic
1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG + Intergenic
1133117107 16:3583572-3583594 GTATCACTCTTTGCTAAGATAGG - Intronic
1136503989 16:30690815-30690837 GTCTCACTCTTTGCCGAGACTGG - Intergenic
1143301082 17:5911122-5911144 GTAGCACACCTTGCCAGGACTGG - Intronic
1143337143 17:6179913-6179935 GAATCATTTTCTGCCAGGGCTGG + Intergenic
1148079671 17:44960693-44960715 GAATTCCTCTTTGCAAGGACAGG - Intronic
1152520082 17:80850563-80850585 AAATCACTCTTGGCCAGGTGCGG - Intronic
1153567406 18:6432093-6432115 GAAATACTCTTTGGCAGGAATGG + Intergenic
1156215821 18:34997146-34997168 GCATCACTATTTGTCAGGAGAGG - Intronic
1159465536 18:68778226-68778248 AAATCTCTCTTTGCCAGAAAAGG + Intronic
1161672366 19:5621491-5621513 GAGTTGCTCTTTGCAAGGACGGG - Intronic
1166458912 19:42968857-42968879 GAATCCCTCTTCCCCATGACGGG - Intronic
927595614 2:24394377-24394399 GTCTCACTCTTTGCCCAGACTGG + Intergenic
928405069 2:31008544-31008566 GAGTGACTCTTTGACAGGACTGG - Intronic
931035225 2:58233826-58233848 AAAGCATTCTTTCCCAGGACTGG - Intronic
934089398 2:88538105-88538127 CAGTCACTGTTTGCCAGGGCAGG - Intergenic
937339260 2:121080484-121080506 GACACACTCTCTGCCAGGAGCGG - Intergenic
938991649 2:136635808-136635830 GAATCATTCTTTCCCAAGGCAGG + Intergenic
941954537 2:171191276-171191298 GAAGCAATCTTAGCCAGGAGTGG + Intronic
942569308 2:177297317-177297339 GAATTCCTCTATGCCAAGACAGG + Intronic
944835808 2:203578592-203578614 AAATCAAAATTTGCCAGGACTGG + Intergenic
945137493 2:206644039-206644061 AAATGACTCATTGCCAGGCCAGG - Intergenic
945409957 2:209496363-209496385 TAATCACACTTTGCCTTGACAGG - Intronic
945739970 2:213647472-213647494 GAATCACTGTATGCCAGCAGCGG - Intronic
948665607 2:239532921-239532943 GAAGAACTCTTCCCCAGGACAGG + Intergenic
1169285199 20:4301901-4301923 GAATCACTCCTTGCCAGAGGTGG + Intergenic
1169832323 20:9838652-9838674 GCATCTCTCTTTGCCGGGAGAGG - Intronic
1169914223 20:10671660-10671682 GCATGACTCATTGCCAAGACTGG - Intronic
1170612982 20:17929355-17929377 GCAGCACTCTTTGGCAGCACAGG + Intergenic
1172767898 20:37360858-37360880 GTATCACTATTTGACAGGAGAGG + Intronic
1173711384 20:45158727-45158749 AAATCACAGTTTGACAGGACTGG + Intergenic
1174898048 20:54471448-54471470 GAATCACTCATTGTTGGGACTGG + Intergenic
1176287758 21:5027751-5027773 GGATGACTCTTGGGCAGGACAGG + Intronic
1177463300 21:21441318-21441340 TAATCACTTTGTGCCAGAACTGG - Intronic
1179869423 21:44235724-44235746 GGATGACTCTTGGGCAGGACAGG - Intronic
1182925823 22:34123751-34123773 GAATCTCTCTTTCCCAAGGCAGG + Intergenic
949563712 3:5226284-5226306 GAATCCCTCTTTTCCAAGGCAGG - Intergenic
949798553 3:7878112-7878134 GAATCTCTCATTCCCAGGAGAGG - Intergenic
952720349 3:36525734-36525756 AAATCACTCTTTCCCAGGTCAGG - Intronic
954206884 3:49065992-49066014 GAATCACTTCTGGCCAGGAATGG + Intronic
957568630 3:81917327-81917349 TAATCACTTTTTGACAGGTCAGG - Intergenic
957701944 3:83726385-83726407 GAATCACTTCTTGACAGGAGAGG + Intergenic
961001060 3:123374317-123374339 GAACCACTGTCTGCCAGGATGGG + Intronic
967847139 3:194053139-194053161 ATAGCACTCTTTACCAGGACAGG - Intergenic
973292206 4:48482223-48482245 AAGTCACTCTGTGCCAGGACAGG + Intergenic
974864148 4:67560044-67560066 TAGTCACACTTTGCCAGGAAAGG + Intronic
980569924 4:134601149-134601171 GAAACACTCATTGCCAGGCATGG - Intergenic
981058819 4:140397230-140397252 GTAACACTCTTCGCAAGGACAGG - Intronic
983113258 4:163780314-163780336 GAATCACTCTTTGCCAGGACAGG + Intronic
984996807 4:185440977-185440999 GTCTCACTCTTTGCCCGGGCTGG + Intronic
986204737 5:5612816-5612838 GAATCACTCTTTATGAGGATTGG + Intergenic
987903789 5:24050136-24050158 GATTCACTTTTGGCTAGGACTGG - Intronic
988183703 5:27832864-27832886 GCATGACTCTTTGCAAGGAAAGG - Intergenic
989378090 5:40786367-40786389 AAATTATTCTTTGCCAGTACTGG - Intronic
997090343 5:130849217-130849239 GTACAACTCTCTGCCAGGACCGG - Intergenic
1000379812 5:160618835-160618857 GAATCATTTTTTACCAGGGCTGG + Intronic
1003718939 6:8678618-8678640 GAGTCCCTCTTTGCTAGGGCAGG + Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1009700347 6:67169616-67169638 GAATCCCTCTGTTTCAGGACTGG - Intergenic
1012357267 6:98330359-98330381 GAATCACTCTTTGAGAACACAGG + Intergenic
1013483834 6:110576268-110576290 GAATCACTCTTCCCCAAGGCAGG - Intergenic
1013879004 6:114870821-114870843 GAAGCACACTTTGCCATGACTGG + Intergenic
1022969481 7:35504268-35504290 GAATCCCTCTTCCCCAGGGCGGG - Intergenic
1027392891 7:77723496-77723518 GTCTCACTCTTTGCCCAGACTGG + Intronic
1030064750 7:105651115-105651137 CACTCACTCCTTGCCAGGCCAGG - Intronic
1030385786 7:108866433-108866455 GAATCCCTCTCTCCTAGGACTGG - Intergenic
1033413905 7:141145674-141145696 GAATCAGACTTTCCCAGGAAGGG - Intronic
1033475564 7:141688795-141688817 GAATCACCCTGTGGCAGGGCAGG - Intronic
1037345123 8:17890695-17890717 GACTCACAGTTTGCCATGACTGG + Intronic
1038585224 8:28782363-28782385 GAAACACTGTTTGCCAGTACAGG + Intronic
1042046635 8:64660366-64660388 GAATCACTCTAAGCCATGCCTGG - Intronic
1047761452 8:127957716-127957738 GAAACACTCGCTCCCAGGACCGG - Intergenic
1050405875 9:5308371-5308393 GAATCACCCCTGGCCAGGTCTGG + Intergenic
1052778868 9:32760218-32760240 GCATCTCCCATTGCCAGGACAGG + Intergenic
1053527052 9:38840903-38840925 GAATTCCTGTTTGCCAGGATTGG + Intergenic
1054199278 9:62065334-62065356 GAATTCCTGTTTGCCAGGATTGG + Intergenic
1054639078 9:67523023-67523045 GAATTCCTGTTTGCCAGGATTGG - Intergenic
1056940766 9:90954136-90954158 GAATCCCATTTTCCCAGGACTGG - Intergenic
1057140040 9:92720909-92720931 GAAGCAGTCTTGGCCTGGACGGG - Intronic
1057177749 9:93011866-93011888 GAATCACTCTAGGCCAGGCGCGG + Intronic
1059735582 9:117096626-117096648 GACTCAGTCTTTGCCAGGCACGG + Intronic
1185503243 X:614753-614775 GAATCCCTCTTCCCCAGCACGGG + Intergenic
1185771219 X:2766964-2766986 GAATCCCTCTTCCCCAAGACGGG - Intronic
1185915273 X:4027742-4027764 GAATCCCTCTTTCCCAAGGCGGG - Intergenic
1186185480 X:7015988-7016010 GAATCCCTCTTCCCCATGACGGG - Intergenic
1186695267 X:12023652-12023674 GGATGACTCTTTGCCAGTAATGG + Intergenic
1187202196 X:17145812-17145834 GAAACACTCAATGCCAGGCCGGG + Intronic
1194156569 X:90397071-90397093 GAATCACTCTTCTGCAAGACAGG - Intergenic
1195572710 X:106414324-106414346 GATTCACTTTTGGCCAGGCCCGG - Intergenic
1196038825 X:111178217-111178239 GAATCACTCTTTGGCTGGCCTGG + Intronic
1197266465 X:124379189-124379211 AAATAACTATTTTCCAGGACGGG - Exonic
1200502917 Y:3974059-3974081 GAATCACTCTTTTGCAAGACAGG - Intergenic