ID: 983114349

View in Genome Browser
Species Human (GRCh38)
Location 4:163794183-163794205
Sequence TCTCATACACTGATGTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983114349_983114350 4 Left 983114349 4:163794183-163794205 CCAGCTAACATCAGTGTATGAGA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 983114350 4:163794210-163794232 TATTTCCTTCTCCTGTTTTGTGG 0: 1
1: 1
2: 7
3: 70
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983114349 Original CRISPR TCTCATACACTGATGTTAGC TGG (reversed) Intronic
904332585 1:29771913-29771935 TCTCATACACTGCTGGTGGGAGG + Intergenic
908411193 1:63867468-63867490 TCTCATACACAGATTCTAGGGGG - Intronic
908991083 1:70090551-70090573 TATTAAACACTGATGGTAGCAGG - Intronic
911690998 1:100834812-100834834 TCTCACATACTGATGATACCAGG - Intergenic
912802711 1:112730554-112730576 TCTCAGTCCCTGAAGTTAGCTGG + Intergenic
916887963 1:169088496-169088518 TCACATACACTCATCTTAGTGGG - Intergenic
918329582 1:183445323-183445345 TCTCATGCACTAATGTTAGGTGG - Intergenic
918750998 1:188269233-188269255 TCTTATACACAGATGTGAGATGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923593006 1:235336938-235336960 TCTCATGCATTGACATTAGCAGG - Intronic
1068024870 10:51630195-51630217 TCTCATACACCGAAGTGAGATGG - Intronic
1068163392 10:53297401-53297423 TCCCATACACTGAAGTGAGATGG - Intergenic
1070379569 10:75868636-75868658 TCTTAGACTCTGATGTTGGCTGG + Intronic
1070889425 10:79930959-79930981 TCTCCTACACTGATGGGATCTGG + Intergenic
1073779242 10:106819162-106819184 TCTCAGACACTGTTCTTTGCTGG + Intronic
1074183806 10:111084588-111084610 TCTCAGAGACTCATGTTTGCTGG + Intergenic
1078338460 11:10482351-10482373 TCTCCCACACTGATGTTTGATGG + Intronic
1079959555 11:26906292-26906314 TCTCATACACTGATTTTTTCTGG - Intergenic
1081186555 11:40049865-40049887 TCTCATACACTGATCTTATAAGG - Intergenic
1085805364 11:79630946-79630968 TCTCATACACTGCTGGTGGGAGG + Intergenic
1089871423 11:121675959-121675981 TCTCATACACTGCTGACAGGAGG - Intergenic
1090510850 11:127373489-127373511 TCTCACCAACTGAGGTTAGCAGG - Intergenic
1092902141 12:13069921-13069943 TCTGATACACTGGTGCTGGCAGG + Intronic
1095265506 12:40152272-40152294 TATCCCACAGTGATGTTAGCTGG - Intergenic
1099958213 12:89371839-89371861 TCTCACACCCTGAAGCTAGCAGG + Intergenic
1101585533 12:106082406-106082428 TCTCATTCACTGCTCTAAGCAGG + Intronic
1104674469 12:130703363-130703385 TTTCAAACACTGATGTTAGATGG - Intronic
1105584237 13:21729268-21729290 TCTCATAATCTGATGTTAGGTGG + Intergenic
1107657516 13:42606718-42606740 TCTCATACCCTGATGAAAGGAGG + Exonic
1110043329 13:70794447-70794469 TCTCATACACTGACAATAGAAGG - Intergenic
1110326232 13:74218738-74218760 TCTAACATAATGATGTTAGCTGG + Intergenic
1110796144 13:79640653-79640675 TCTCATCCACTGCTGGTAGGAGG - Intergenic
1112137814 13:96602406-96602428 CTTCATACACTGATTTTGGCTGG + Intronic
1114235733 14:20822016-20822038 TCTCAAGCACTGATCTTAGGAGG + Intergenic
1115639130 14:35320927-35320949 TCTCATCCACTGATTCTAGGAGG - Intergenic
1116633953 14:47369484-47369506 TCTCATACATTGCTGTGAGAAGG - Intronic
1118040930 14:61915870-61915892 ACTGATGCACTGATGTCAGCAGG - Intergenic
1120119257 14:80657875-80657897 TAACATGTACTGATGTTAGCAGG + Intronic
1122405793 14:101500225-101500247 TCCCATACACAGCTCTTAGCCGG + Intergenic
1126047078 15:44651905-44651927 TTTCATTCAATGATGATAGCTGG + Exonic
1127314354 15:57780770-57780792 TCTCTTGCAATGATGCTAGCTGG + Intronic
1128637187 15:69310354-69310376 TCTCATCCACTGCTGGTAGGTGG - Intronic
1131335182 15:91542231-91542253 TCTCACACTGTGATGTAAGCCGG + Intergenic
1133367303 16:5220709-5220731 TCACAAAGACTGATGTTATCAGG - Intergenic
1133380486 16:5326067-5326089 TCTCATACACTGCTGTCTGACGG - Intergenic
1140532664 16:75680163-75680185 TTTGATAAACTGATGTTATCTGG + Intronic
1142912399 17:3105804-3105826 TCTCATACACTGCTGGCAGTAGG - Intergenic
1143966875 17:10761854-10761876 TCTTATTCACTGATCTCAGCTGG - Intergenic
1145771794 17:27498626-27498648 TCTCAAACACTAGTGTTATCGGG - Intronic
1160112977 18:76051174-76051196 TCTCAAACACTGTTGAAAGCAGG + Intergenic
1163877204 19:19882289-19882311 TTTCATAAACTGATTTTAGAAGG + Intronic
1163882259 19:19935409-19935431 TTTCATAAACTGATGTTAGAAGG - Exonic
1165654238 19:37519320-37519342 TCTCTTACACTGCTGGTAGGAGG - Intronic
925156034 2:1649463-1649485 TCTCGTACACGGATTTCAGCAGG + Exonic
925842169 2:8002641-8002663 TCTCAAACACTTTTGTTTGCTGG + Intergenic
926579458 2:14618755-14618777 TCTCTTATACTGATTTTGGCAGG - Intergenic
926774405 2:16407670-16407692 TCTCTTACAATGGTGATAGCAGG + Intergenic
929723404 2:44396624-44396646 TCTCATACACTGTTGGTGGAGGG + Intronic
931113779 2:59142520-59142542 TCTGATCCACTGATGTTGGTAGG + Intergenic
936112153 2:109673814-109673836 TCTCATACATTGTTGATAACAGG - Intergenic
937310780 2:120902039-120902061 TCTCACAAGCTGGTGTTAGCTGG - Intronic
937345096 2:121120582-121120604 TATGATACACTGATGCTAGGCGG + Intergenic
937481598 2:122266351-122266373 TTTCCTACAATGCTGTTAGCTGG + Intergenic
937670767 2:124535169-124535191 CCTCATACAGTGATGCTACCGGG + Intronic
942815057 2:180043052-180043074 TCTCTTACACTGATTTTAGGGGG + Intergenic
948543105 2:238703812-238703834 TCTCAAAGATTGATGTTGGCTGG + Intergenic
948614208 2:239187945-239187967 TGTCAAACACTGACATTAGCAGG + Intronic
1170088937 20:12568720-12568742 ACTCATAAACTTATGTGAGCAGG + Intergenic
1177600760 21:23310217-23310239 TCTCATAGCCTGTTTTTAGCAGG - Intergenic
1180656966 22:17430003-17430025 TCTCATACACTGTTGGTGGGGGG - Intronic
1182053107 22:27328267-27328289 TCTCACAGACTGTTGTAAGCGGG - Intergenic
1184672210 22:46020083-46020105 ACTAATACACTTATGTTAGAAGG + Intergenic
949201893 3:1389520-1389542 TGTCATATTATGATGTTAGCTGG - Intronic
949204705 3:1423931-1423953 TCTCAGACACTGACGTTTTCAGG - Intergenic
949531061 3:4955722-4955744 TCTGATACAATGATGCTAGGAGG + Intergenic
950040974 3:9918949-9918971 TCCCATACACTGCTGGTAGGAGG - Intronic
950456198 3:13094148-13094170 ACTGATACACCGATGGTAGCAGG + Intergenic
953283495 3:41581514-41581536 TGTGATACAAGGATGTTAGCAGG - Intronic
957725932 3:84067260-84067282 TCTCAAGCACTGATCTTAGGAGG + Intergenic
957781973 3:84830692-84830714 TCCCATACAGTGATGTTACAAGG - Intergenic
963145175 3:141986753-141986775 GCTCATACACTGCTGGTGGCAGG - Intronic
965165581 3:165191971-165191993 TTTCATATACTGATGTTATTAGG - Intronic
966287254 3:178312355-178312377 ACTAATACACTAATGTTTGCCGG + Intergenic
967256229 3:187594822-187594844 TATCAAACAATGATGTAAGCTGG - Intergenic
971034972 4:22683170-22683192 TATCATACCCTGTTGTCAGCTGG + Intergenic
971654579 4:29326931-29326953 GCTAATTCACTGGTGTTAGCTGG - Intergenic
974553350 4:63409790-63409812 TTTCATTTACTTATGTTAGCCGG + Intergenic
975405689 4:73986696-73986718 TCTTATAAACTGTGGTTAGCTGG - Intergenic
976147248 4:82054047-82054069 TCTCATGCCCTGATCTTACCAGG - Intergenic
977621726 4:99145444-99145466 TCTCATACACTGCTGCTGGTAGG - Intronic
981730697 4:147894216-147894238 TCTCATACACTGCTGATGGGAGG - Intronic
983114349 4:163794183-163794205 TCTCATACACTGATGTTAGCTGG - Intronic
986626647 5:9729104-9729126 ACTCATACTCAGAGGTTAGCTGG + Intergenic
990471084 5:56116199-56116221 TCTCATAAACTAAAGTTATCTGG + Intronic
995463972 5:112431748-112431770 TCTCATACACAGAAGTGAGATGG - Intergenic
995825375 5:116291430-116291452 TGTCATATTCTGAGGTTAGCTGG + Intronic
998845305 5:146302950-146302972 TGTCATATACTGATGACAGCAGG + Intronic
1005462761 6:26084757-26084779 TCTCATACACTGCTGATAGGAGG + Intergenic
1005971029 6:30761920-30761942 TCTCATGAACTGGTGTGAGCTGG - Intergenic
1007825505 6:44597173-44597195 CCTCATACACTGCTGGTAGGGGG - Intergenic
1011028829 6:82898959-82898981 TCTCCTACTCTCATTTTAGCAGG - Intronic
1015311614 6:131773077-131773099 TCTCAAGCACTGATTTTAGGAGG + Intergenic
1020427604 7:8086665-8086687 TCTTAAACACTGATCTTGGCAGG + Exonic
1022154688 7:27647726-27647748 CCTCATACTCTGAAGTTACCAGG - Intronic
1031005888 7:116471105-116471127 TATCATACATTGATTTTGGCAGG - Intronic
1044651123 8:94497038-94497060 TCACATACACTTATGGTAGAGGG + Intronic
1044755134 8:95453617-95453639 TCTCATACACTGCTGGTGGAAGG - Intergenic
1045771079 8:105741466-105741488 GCTGAAACACTGATGTTTGCAGG + Intronic
1045964603 8:108010406-108010428 TCCCAGACACTTATGTGAGCAGG + Intronic
1046515543 8:115254790-115254812 TCTCAAGCTCTCATGTTAGCTGG - Intergenic
1051165636 9:14259572-14259594 TGCCATACATTGATGTTGGCAGG + Intronic
1053318129 9:37070313-37070335 ACTCATACACTGTTGGTAGGAGG - Intergenic
1057211206 9:93202054-93202076 TCTCACACTCTGATGCTACCTGG + Intronic
1060859658 9:126944117-126944139 TCCCATACACTGCTGCTGGCTGG - Intronic
1189246904 X:39570358-39570380 TCTCACACACTGATCTTAGCTGG - Intergenic
1197042969 X:121962276-121962298 TCTCAAGCACTGATCTTAGGAGG + Intergenic
1197672633 X:129295356-129295378 ACTCATACACTGTTGTTAGTGGG + Intergenic
1197808087 X:130416377-130416399 CCTCATGCACTGAGGTCAGCAGG - Intergenic
1198040606 X:132847891-132847913 TGTCATGCACTGATGCTAGCTGG - Intronic
1198201602 X:134425123-134425145 CCTCATCCACTAATGTTGGCAGG + Intronic
1198564206 X:137886831-137886853 ACTCATATACTGAGGTTTGCTGG + Intergenic
1199122829 X:144077148-144077170 TCACATACACTGATGATTTCTGG - Intergenic