ID: 983116014

View in Genome Browser
Species Human (GRCh38)
Location 4:163817112-163817134
Sequence TGGGCGTTTCCAAAATACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983116014 Original CRISPR TGGGCGTTTCCAAAATACCC TGG (reversed) Intronic
914678606 1:149923345-149923367 TGTGCATTTGCAAAATACTCAGG + Exonic
916076358 1:161202054-161202076 CGCGCGTTTCCAAGATACGCAGG + Intronic
924485497 1:244479441-244479463 TGGGCATTGCCAAAAGTCCCTGG + Intronic
1066496654 10:35948755-35948777 TGGCAGTTTCCAAAATAACATGG - Intergenic
1066533376 10:36364463-36364485 TAGCAGTTTCCAAAATGCCCTGG - Intergenic
1069651834 10:70054199-70054221 GGGCCGTTGCCAAAAAACCCTGG - Intronic
1070310889 10:75273064-75273086 TGGGCGTTTCCTGAATGTCCAGG + Intergenic
1083422916 11:62565763-62565785 TGGTCTTGTACAAAATACCCGGG + Intronic
1089278392 11:117355366-117355388 TGGGCTTCTCCAAAATATGCAGG + Intronic
1090845570 11:130527311-130527333 TTGGAGTTTCCTAAAGACCCTGG - Intergenic
1103624159 12:122205849-122205871 TGGGCGTCTCCAAGATGACCAGG - Intronic
1114215967 14:20658022-20658044 TGGGCGCTTCCATAATAGTCTGG + Intergenic
1117057433 14:51927505-51927527 TAGGTGTTTCCACCATACCCTGG + Intronic
1118571685 14:67200502-67200524 TGTGCATTTGCAAAATACTCAGG - Intronic
1124573449 15:30886292-30886314 TAAGTGTTTCCAAAATACCATGG - Intergenic
1133642732 16:7733499-7733521 TGTGCTTTCCCAGAATACCCCGG + Intergenic
1139201118 16:64978079-64978101 TGGGGGTTCCCAATATACCTAGG - Intronic
1141843062 16:86586827-86586849 TGGGCGAATCCAAAATTCCCAGG - Intergenic
1142595295 17:1026920-1026942 GGGGCGCTTCCAAAATGCCTGGG + Intronic
1143225407 17:5298090-5298112 TGGGCTTTTCCGAAATAGCAAGG - Intronic
1147213670 17:38886738-38886760 TGGGCGCCTCCAAGACACCCAGG - Intronic
1149494736 17:57110080-57110102 TGAGAGCTTCCAAAATGCCCAGG + Exonic
1152307069 17:79527339-79527361 TGGGCGTTTCCAAAAAGACCTGG - Intergenic
1153946322 18:10021208-10021230 TATGCTTTTGCAAAATACCCAGG - Intergenic
1155794412 18:30017102-30017124 TGGGAGTTTTCAAAATATTCAGG - Intergenic
1156636740 18:39040570-39040592 TGCTCATTTCCAACATACCCAGG + Intergenic
1160179865 18:76624716-76624738 TGTGGGCTTCCAAAATCCCCAGG - Intergenic
1163714354 19:18865414-18865436 TTGGCTTGTCCAAAATAGCCAGG - Exonic
1165169092 19:33878573-33878595 TGGTTGTTTACAAAATACTCAGG + Intergenic
1166548601 19:43649865-43649887 TGGGCTTTTCCAAAAACTCCAGG + Intronic
942346026 2:175004623-175004645 TGTGCGTTTGCAAAACACCCAGG + Intronic
948142947 2:235687655-235687677 TGTCCGTTTCCAAAATACACAGG + Intronic
1171222214 20:23409024-23409046 TGGGCCTTTCCACCATACCTTGG - Intronic
1173595401 20:44255837-44255859 TGGGCTTGTCCAAGATCCCCTGG - Intronic
1174993514 20:55540136-55540158 TAGCCTTTTCCAAAATACCTTGG - Intergenic
1175224126 20:57434973-57434995 TGGCAGGCTCCAAAATACCCAGG + Intergenic
1178499420 21:33113443-33113465 TGGGCGTTTCCAACATAAAAAGG + Intergenic
1178531685 21:33381560-33381582 TGGGGGTTTCCACATTGCCCAGG + Intergenic
1179143273 21:38746092-38746114 TGGGCATTTCCTAAGTACCAGGG - Intergenic
1179602555 21:42489887-42489909 CGGGGGCTTCCAAAAAACCCAGG + Intronic
1180560216 22:16609706-16609728 TGGCCGTTTCCAACTTGCCCCGG + Intergenic
950160620 3:10758022-10758044 GGGGCTTTTCCAAACTTCCCTGG + Intergenic
953332047 3:42061858-42061880 TATCCGTTTCCAAAATAACCTGG - Intronic
954292876 3:49658951-49658973 TGGGCTTTTCCTAAAGACCCTGG + Intronic
956217765 3:66867511-66867533 TGAGCTTTTACAAAATGCCCTGG - Intergenic
957655079 3:83063686-83063708 TATGCGCTTCCAAAATACACTGG + Intergenic
963810622 3:149773057-149773079 TGGGAATTTCCAGAATTCCCTGG + Intronic
967143201 3:186581460-186581482 TGGGCGCTTCCAAATGACCCAGG + Exonic
968592690 4:1466699-1466721 TGGCTGTTTCCAAAATTCCTGGG + Intergenic
983116014 4:163817112-163817134 TGGGCGTTTCCAAAATACCCTGG - Intronic
987763493 5:22194933-22194955 TGGGAGTTTCACAAATAGCCAGG + Intronic
1005341534 6:24848048-24848070 TGGGCGTTTCCGGGGTACCCTGG + Exonic
1008930344 6:56932453-56932475 TGTGGCTTTCCAGAATACCCTGG - Intronic
1010313271 6:74413537-74413559 TGGGTGTTTTAAAAACACCCGGG + Intergenic
1017334106 6:153234727-153234749 TGAGCAATTCCAAACTACCCAGG - Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1026378672 7:69777139-69777161 TGGGCATTTCCAGATGACCCTGG + Intronic
1032155756 7:129466294-129466316 TGGGGCTTTGGAAAATACCCTGG + Intronic
1035360820 7:158313286-158313308 TGGGCATTTCCAGCAAACCCTGG - Intronic
1036140147 8:6200131-6200153 TGGGTTTTTCCATAATGCCCAGG + Intergenic
1055039494 9:71854111-71854133 AGGGCTTTTCCACATTACCCAGG + Intergenic
1056054091 9:82802580-82802602 TGGGAATTTCCAAAATATCCTGG - Intergenic
1059518051 9:114914002-114914024 TGGGCCTTCTCAATATACCCTGG - Intronic
1060558207 9:124521097-124521119 TGGGCCCTTCCAACCTACCCAGG + Exonic
1185503824 X:618129-618151 TGGGCGTTTCAGAACTCCCCTGG + Intergenic
1189790763 X:44602719-44602741 TGGGAGTTTCCAGAATAGACTGG + Intergenic