ID: 983118706

View in Genome Browser
Species Human (GRCh38)
Location 4:163852641-163852663
Sequence GATTGTAAGGGGAGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983118706 Original CRISPR GATTGTAAGGGGAGGGCTGA AGG (reversed) Intronic
902040099 1:13486266-13486288 CCTTGTAAGGGAAGGGCAGAGGG - Intronic
904331587 1:29761367-29761389 GATGGTGGGGGCAGGGCTGAGGG + Intergenic
905464355 1:38141426-38141448 GATTGGGAGAGCAGGGCTGAAGG - Intergenic
905940508 1:41859500-41859522 GAATGTAAGGGTAGGGATGTGGG + Intronic
907809880 1:57858603-57858625 GCTTGTTAGGGGGTGGCTGAGGG + Intronic
908440360 1:64147577-64147599 GTTTGTTAGAGGTGGGCTGAGGG - Intronic
908830597 1:68174671-68174693 GATTTTAAGGGAAAGGCTGAGGG - Intronic
910255611 1:85244398-85244420 GATTGGAAGGGAAGGCCTCAAGG + Intergenic
914241762 1:145857519-145857541 GGTTGGGAGGGGTGGGCTGAAGG - Intronic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
915918917 1:159959641-159959663 GACTTCAAGGGGAGGGCTTAGGG - Intergenic
917771289 1:178282024-178282046 GACTACAAGGGGAGGGTTGAGGG + Intronic
921556652 1:216606581-216606603 GGTTGTGGGGGGAGTGCTGAGGG - Intronic
922828694 1:228539427-228539449 AATTGTAAGGGGAGGACTCCTGG - Intergenic
923155511 1:231275196-231275218 GATTTTAAGAGGAAGGATGAGGG - Intronic
924407224 1:243760660-243760682 GTTTGTAATAGGAGAGCTGAAGG - Intronic
924498493 1:244613596-244613618 TATTGTAAGGGGAGGGATAAAGG - Intronic
1062833573 10:622251-622273 GATGGTAGGGGGAGGGAGGAGGG + Intronic
1062931060 10:1352989-1353011 GGTTCTAAGAGGAGGGCTGGTGG - Intronic
1063045070 10:2383608-2383630 GATGGTGAGGGGAGGGTTGCTGG + Intergenic
1068216070 10:53984011-53984033 GATTCTGAGCGGAGGTCTGAAGG - Intronic
1068644535 10:59451055-59451077 AATTGTTAGGTGTGGGCTGAAGG - Intergenic
1068841690 10:61621773-61621795 GAGGGTAAGGGCAGGGCAGAGGG + Intergenic
1070268755 10:74931296-74931318 GGTGGAAAGGGGAGGGGTGATGG - Intronic
1071121909 10:82288043-82288065 GATTATAAGGGGAGCCCCGATGG + Intronic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1072042869 10:91626072-91626094 GATGGTATGGGCAGGGCTGGGGG + Intergenic
1076321743 10:129588100-129588122 GATTGTAAGAGGAGAGATCATGG + Intronic
1078170816 11:8927669-8927691 GACTGCAAGGGCAGTGCTGAGGG - Intronic
1080169450 11:29281772-29281794 GGTTGTGAGGGGAGGGCTGGGGG + Intergenic
1081616947 11:44596715-44596737 GAGTGAAAGAGGAGGGCTGGAGG + Intronic
1081835339 11:46149110-46149132 GATAGTAAGAGGGTGGCTGAAGG + Intergenic
1081835443 11:46149679-46149701 GATAGTAAGAGGATGGCTGAAGG - Intergenic
1081857309 11:46312007-46312029 GATTGTAGGGAGGGGTCTGAGGG + Intronic
1082878134 11:58009255-58009277 GAATCTAAGGGTAGGTCTGAGGG + Intergenic
1083709099 11:64536728-64536750 GATTGTGTGGGGAGACCTGAAGG + Intergenic
1087009800 11:93502316-93502338 GAGGGTAGGGGGAGGGCTGTTGG - Intronic
1088795832 11:113266078-113266100 GTTAGTCAAGGGAGGGCTGAGGG + Intronic
1089424369 11:118359452-118359474 GCTTGTTAGGGGCGGGCTGGAGG - Intergenic
1089813028 11:121147384-121147406 GATTGTAAGGGAAGGGTGGGAGG + Intronic
1090335428 11:125959795-125959817 GAAAGAAAGGGGAGGGCTGCAGG - Exonic
1092202245 12:6593077-6593099 CAGTCTAAGGTGAGGGCTGAGGG - Exonic
1093345928 12:18038283-18038305 TAGTGAAAGGGGAGGGGTGATGG - Intergenic
1095316084 12:40763379-40763401 GAATTTAAGGGGAGATCTGAAGG + Intronic
1095944267 12:47745228-47745250 GATTGGAGGAGGAGGGCTGGAGG - Intronic
1098914612 12:76244162-76244184 GATAGTCAGGGAAGGACTGATGG + Intergenic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1100208511 12:92377024-92377046 AATTTTATGGGGAGGGCAGAAGG + Intergenic
1100682887 12:96948219-96948241 AAGTGTAACAGGAGGGCTGAGGG - Intronic
1104471448 12:129033051-129033073 CATTGTAAGGGGCGGAGTGAGGG - Intergenic
1105946513 13:25194992-25195014 GATAGTAAGGGGAGGTTTGTGGG + Intergenic
1107274344 13:38660792-38660814 GATTGTGTGGGGTGGGTTGAAGG + Intergenic
1107859772 13:44649861-44649883 GATTGTATGGGCAGACCTGAGGG + Intergenic
1110216415 13:73029540-73029562 GACTTTACGGGAAGGGCTGAGGG - Intergenic
1113267378 13:108634395-108634417 GAGAGAAAGGGGAGAGCTGAAGG - Intronic
1113757416 13:112822868-112822890 GCTTGTTAGGAGAGGGCTGCTGG + Intronic
1114194930 14:20469090-20469112 GGTTGCAAGGAGAGGGCTGGGGG + Intronic
1115291727 14:31779624-31779646 GATTGTGAAAAGAGGGCTGAGGG + Intronic
1118031783 14:61825183-61825205 GCTTGTAAGGGCAGGGTTGTGGG + Intergenic
1119983803 14:79113126-79113148 AATTGGAAGGGGAGTGCTGCTGG - Intronic
1122164588 14:99812557-99812579 GATTGTACAGGGAGGGCCGTGGG - Intronic
1123022708 14:105409169-105409191 GATTGTAGGGGGAGGGGAGAGGG - Intronic
1124487388 15:30131121-30131143 GACTGTTAGGGAAGGCCTGATGG - Intergenic
1124542478 15:30600095-30600117 GACTGTTAGGGAAGGCCTGATGG - Intergenic
1124756139 15:32407202-32407224 GACTGTTAGGGAAGGCCTGATGG + Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128867070 15:71121981-71122003 GGTTGTAAGGTGAGCCCTGAGGG + Intronic
1128956143 15:71947739-71947761 AATTGCCAGGGAAGGGCTGAGGG - Intronic
1129604101 15:77016389-77016411 GGTGGGAAGGGGAGGGCTGCTGG + Intronic
1129608952 15:77038154-77038176 GACTGTAAGGGGCGGGATGGGGG + Intergenic
1130893744 15:88154381-88154403 GATTTTAAGGGGTTGGCTCATGG - Intronic
1133095314 16:3441082-3441104 GGTTCTAAGGGGTGGGGTGAGGG + Intronic
1139256352 16:65546614-65546636 CATTGTGAGGGGAGGGTTGGGGG + Intergenic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1141285296 16:82666391-82666413 GATTGGAGAGGGAGGGCTGATGG - Intronic
1141638897 16:85329840-85329862 GAATGTGTGGGGAGGGCGGAGGG + Intergenic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1146197175 17:30824053-30824075 TATTGGAAGGGGAGGACTAAGGG - Intronic
1149972894 17:61236735-61236757 TGTTGTAAGTGGAGGGATGATGG + Intronic
1150255257 17:63739564-63739586 TAATGGAAGGGGAGGGCAGATGG + Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1152244759 17:79179534-79179556 TATTGTAAGGGGAGGGGAGGGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152591736 17:81216893-81216915 GGATGTCAGGGGAGGGATGAAGG + Intronic
1155146110 18:23084945-23084967 GATTGTCAGATGAGCGCTGAGGG - Intergenic
1158491968 18:57918254-57918276 GATGGTCAAGGGAGGGCTGGAGG - Intergenic
1158806353 18:60978273-60978295 AATAGTAACTGGAGGGCTGAGGG - Intergenic
1161101570 19:2424429-2424451 GGTGGTCAGGGGAGGGCTGCAGG - Intronic
1163852850 19:19675659-19675681 GAGTGTAAGGGGTGAGGTGAGGG + Intronic
1165205514 19:34181915-34181937 GATTAGATGGGGAAGGCTGATGG - Intronic
1165452179 19:35890059-35890081 AAAAGTAAGGGGAGGGCTGGTGG + Intronic
1165931870 19:39364320-39364342 GAATGTCAGGGTAGGGCTGGAGG + Intronic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1168548461 19:57273285-57273307 CATTGAACTGGGAGGGCTGAAGG + Intergenic
925018864 2:553197-553219 CATGGTATGGGCAGGGCTGAGGG + Intergenic
925373249 2:3362524-3362546 GGTTTTAAGCGGTGGGCTGAAGG + Intronic
926327633 2:11799039-11799061 CATTGTAAGGGGTGGGGTGGGGG + Intronic
926728995 2:16020565-16020587 CATTGAAAGGGGAGTCCTGAAGG - Intergenic
927121701 2:19970470-19970492 GATTGAATTGGGAGGGCAGAGGG - Intronic
927668279 2:25047242-25047264 AATAGCAAGGAGAGGGCTGAAGG - Intronic
927703217 2:25281002-25281024 ATTTGGAAGGGCAGGGCTGATGG + Intronic
929054488 2:37863913-37863935 GATTACATGGTGAGGGCTGAGGG - Intergenic
930826339 2:55700316-55700338 GATGGGAAGGGGAAGGCTGAGGG - Intergenic
931218919 2:60271498-60271520 GATTTTGAGGGGAGAGGTGAGGG + Intergenic
931670084 2:64639911-64639933 GCCTGGAAGGGGAGGGCAGAGGG + Intronic
934580961 2:95437602-95437624 GAAAGAAAGGGGAGGGCTGCAGG + Intergenic
934598489 2:95639112-95639134 GAAAGAAAGGGGAGGGCTGCAGG - Intergenic
935005554 2:99072712-99072734 GAGTGTAAGGGGAGAAGTGAAGG - Intronic
938715677 2:134019412-134019434 AATTGTAAGGGGATGGCCCAGGG - Intergenic
939606092 2:144255920-144255942 GATGGTTGGGGGAAGGCTGAAGG + Intronic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
942427171 2:175872250-175872272 GAATGAAATGGGAGGTCTGAGGG + Intergenic
944803886 2:203261978-203262000 GCATCCAAGGGGAGGGCTGATGG + Intronic
946370137 2:219276409-219276431 CATTGTATGGGCAAGGCTGAGGG - Intronic
1169287036 20:4318069-4318091 AATTGGAAGTGGAGGGCAGAGGG + Intergenic
1170810891 20:19673484-19673506 GATAGTAAGGAGAAGGCAGACGG - Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173202055 20:40961486-40961508 GATGGCAGGGGGAAGGCTGAGGG - Intergenic
1173361199 20:42346188-42346210 GATGGGAAGGGGAGGAATGAGGG + Intronic
1175606913 20:60318602-60318624 TATTCTGAGGGGAGGGCTGGGGG - Intergenic
1184248511 22:43247686-43247708 GCTTGGATGGGGAGGGCTGCAGG + Intronic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185131335 22:49040809-49040831 GGGTGTCAGGGGAGGGCTGGGGG + Intergenic
950053211 3:10007583-10007605 GGGTGTCAGGGGAGGGTTGATGG + Intronic
950480481 3:13240614-13240636 GATTGTGAGGGTGGCGCTGAGGG - Intergenic
950718344 3:14865244-14865266 GCTTGGAAGGGGAGGGATGATGG - Intronic
953876520 3:46669859-46669881 GCCTGTGAGGGGAGGGTTGAGGG - Exonic
953884220 3:46706467-46706489 CATTCTGAGGGGAGGGCTAAGGG - Intronic
955335013 3:58078084-58078106 GTTGGGTAGGGGAGGGCTGAAGG + Intronic
955671768 3:61409830-61409852 GACAGGAAGGGGAGGGCTGTCGG + Intergenic
955965570 3:64385585-64385607 GATTGTATGAGGAGGCCTCATGG - Intronic
957366761 3:79234820-79234842 GATTGTAGGGGGAGGGAGAAGGG + Intronic
958632848 3:96703620-96703642 GAATGATAGGGGAGGGCTCAGGG + Intergenic
959268181 3:104170379-104170401 GATTGTAATTGGAGGGTTAATGG + Intergenic
962176553 3:133161287-133161309 GATGTTAAGGTGAGAGCTGATGG - Intronic
962256404 3:133872884-133872906 GATGGAAAGGGGAGGGTAGAGGG + Intronic
967195538 3:187022366-187022388 GAGGGTTAGGGGAGGGCTGAGGG + Intronic
967383752 3:188889357-188889379 GATTGTAGGAGAAGGGTTGAAGG + Exonic
969519194 4:7665977-7665999 GATTGTCAGGTGTGGGCTGCAGG + Intronic
969661952 4:8535565-8535587 GATTGTCAGGTGAGGGCAGGAGG - Intergenic
969692171 4:8709788-8709810 GTGTGGAAGGGGAGGGCTGTGGG - Intergenic
972668975 4:41195702-41195724 GGATCTAAGGGTAGGGCTGAAGG - Intronic
978161726 4:105556495-105556517 AATGGTAAGGGTAGGGATGAGGG + Intronic
979464287 4:121018461-121018483 AATTGTAAAGGGAGGACAGAGGG + Intergenic
979598377 4:122559150-122559172 AATTGGAAAGGGAAGGCTGAAGG + Intergenic
983118706 4:163852641-163852663 GATTGTAAGGGGAGGGCTGAAGG - Intronic
984955578 4:185042437-185042459 GGTAGTGAGGGGAGAGCTGATGG + Intergenic
989398692 5:40985854-40985876 GTTTGAAAGGGGTGGGCTGGAGG + Intergenic
989516631 5:42351457-42351479 GATTTTCAGGGGTGGGGTGATGG + Intergenic
990531967 5:56683145-56683167 GATTCTAGGGGTAAGGCTGAAGG + Intergenic
992484170 5:77179986-77180008 GATTGTGAGTTGAGGGCTGCAGG + Intergenic
996336222 5:122387035-122387057 GCTTGTAGGGTCAGGGCTGATGG + Intronic
997240514 5:132303416-132303438 AAGGGGAAGGGGAGGGCTGAAGG - Intronic
997512378 5:134462447-134462469 GGTTGTAAAGGGAGTGCTGGAGG - Intergenic
997724699 5:136110719-136110741 GAGTGTAAGCAGAGAGCTGATGG + Intergenic
1000225441 5:159256544-159256566 GGTTGTCAAGGGAGGCCTGATGG + Intergenic
1001746953 5:174099458-174099480 GTTTGCAGGGGGATGGCTGAAGG - Intronic
1003327552 6:5104154-5104176 GATTGGAAGAGGAGGGCTGGTGG - Intronic
1005871403 6:29976570-29976592 GAATCTAAGGCGAGTGCTGAGGG - Intergenic
1006034060 6:31198192-31198214 GAATCTAAGGCGAGTGCTGAGGG + Intronic
1006298623 6:33181298-33181320 GAGTTTTAGGGGAGGGCTGTGGG - Intronic
1016993041 6:149942694-149942716 GATGGTGAGGGGAGGGGTGGCGG - Intronic
1017005294 6:150024830-150024852 GATGGTGAGGGGAGGGGTGGCGG + Intronic
1018392829 6:163353425-163353447 GATTTTCTTGGGAGGGCTGAGGG - Intergenic
1018905212 6:168071971-168071993 GATGCTAAGGGGAGAGCTCACGG - Intronic
1021593776 7:22293334-22293356 GATTCCAAGGGGAGAGCTGAGGG - Intronic
1022737851 7:33092686-33092708 ATTAGTAAGGGGAGGTCTGAGGG + Intergenic
1024501167 7:50107736-50107758 GAATGTAAGGGGATGCCTCAGGG - Intronic
1026583810 7:71639515-71639537 GATTGCACGAGGAGGGCTGTGGG + Intronic
1027402316 7:77821947-77821969 GATTGCAGGTGGAGAGCTGAGGG + Intronic
1027950680 7:84810878-84810900 AATTGTCAGGGGAGGGGTGGTGG - Intergenic
1030388881 7:108900759-108900781 GAATGAGAGGGGAGGGATGAAGG - Intergenic
1036190181 8:6662969-6662991 GAAGGTGAGGGGAGGTCTGAGGG + Intergenic
1038072390 8:24031448-24031470 GATTCTGATGGGAGGGGTGAGGG + Intergenic
1038096125 8:24312379-24312401 GATTGAAAATGCAGGGCTGAGGG - Intronic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1039838984 8:41280145-41280167 GAGTGCAGGGGGAGGGCTGACGG + Intronic
1042870451 8:73393157-73393179 GATCGTAATGGGGAGGCTGAGGG - Intergenic
1042909305 8:73808836-73808858 GAATGTAAGGGGAATGGTGAGGG + Intronic
1044175795 8:89120604-89120626 CAGTGTGAGGGGAGGCCTGAAGG - Intergenic
1045816257 8:106280558-106280580 GTTTGCAAGGGGATGGGTGATGG + Intronic
1046603400 8:116343765-116343787 CTTTGTCAGGGGATGGCTGATGG + Intergenic
1047856668 8:128918662-128918684 GATTCTAAGAGGCGGGCTGGTGG - Intergenic
1048693098 8:136989703-136989725 GAGTCTGAGGGGTGGGCTGAGGG - Intergenic
1049270593 8:141693610-141693632 GATGAGAAGTGGAGGGCTGAGGG + Intergenic
1049410023 8:142469037-142469059 GCTTGTAAGTGGCAGGCTGATGG + Intronic
1049598150 8:143494092-143494114 GAGGGGAAGGGGAGCGCTGAGGG + Intronic
1049769584 8:144373756-144373778 GATAATCCGGGGAGGGCTGAGGG - Intronic
1049997672 9:1047209-1047231 GATTGAAAGGCGAGGGCTCAAGG - Intergenic
1050127052 9:2368050-2368072 GATTGTAGATGCAGGGCTGATGG - Intergenic
1050596661 9:7211283-7211305 GATGGTCAGGAGAGTGCTGAGGG - Intergenic
1051942386 9:22523701-22523723 GATTCTATGGGGAAGCCTGATGG + Intergenic
1055613067 9:78042966-78042988 GATTGTAAAGGAAAGGCAGACGG + Intergenic
1061089536 9:128419300-128419322 CACTGCAAGGGGAGGGCTGAAGG - Intronic
1061209431 9:129182288-129182310 GATTGGAAGGACAGGGCTGGAGG + Intergenic
1061405315 9:130390534-130390556 GAATGAAGGGGGAGGCCTGAAGG + Intronic
1061942652 9:133891684-133891706 GAATGGAAGGGGAGGGATGAAGG + Intronic
1187073339 X:15910598-15910620 GATTGGAAGGTGAGGGTTGGGGG + Intergenic
1187261680 X:17690484-17690506 GACTGTAAGGAGAGAGCTGGAGG + Intronic
1192149343 X:68702274-68702296 GATTCTAAAGGGAGAGCCGAGGG + Intronic
1193250049 X:79280260-79280282 TATTGTAAGTGGTGGGTTGATGG + Intergenic
1193333270 X:80259265-80259287 GATGGTTAGAGGTGGGCTGAGGG - Intergenic
1194908220 X:99605499-99605521 GATAGAAAGGGAAGGACTGACGG - Intergenic
1195342643 X:103919975-103919997 GGTAGTAGGGAGAGGGCTGAGGG + Intronic
1196275270 X:113759530-113759552 GGTTGTAAGGGGCTTGCTGAAGG + Intergenic
1199698476 X:150360438-150360460 GACTGCAAGGAGAGGGTTGAAGG + Intergenic
1200230958 X:154443758-154443780 GCTTGAAAGGAGAGGGCAGAGGG + Intergenic
1202268133 Y:23042493-23042515 CATTGTAAGTGCAGGGCTAAAGG - Intergenic
1202421125 Y:24676237-24676259 CATTGTAAGTGCAGGGCTAAAGG - Intergenic
1202449661 Y:24993845-24993867 CATTGTAAGTGCAGGGCTAAAGG + Intergenic